ID: 1006429153

View in Genome Browser
Species Human (GRCh38)
Location 6:33984503-33984525
Sequence TTCCCCCAGCGCCCCTGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006429153_1006429159 3 Left 1006429153 6:33984503-33984525 CCAGGCCAGGGGCGCTGGGGGAA No data
Right 1006429159 6:33984529-33984551 GGCTCAGGCCCGCCGCTCTGGGG No data
1006429153_1006429158 2 Left 1006429153 6:33984503-33984525 CCAGGCCAGGGGCGCTGGGGGAA No data
Right 1006429158 6:33984528-33984550 AGGCTCAGGCCCGCCGCTCTGGG No data
1006429153_1006429157 1 Left 1006429153 6:33984503-33984525 CCAGGCCAGGGGCGCTGGGGGAA No data
Right 1006429157 6:33984527-33984549 CAGGCTCAGGCCCGCCGCTCTGG No data
1006429153_1006429163 18 Left 1006429153 6:33984503-33984525 CCAGGCCAGGGGCGCTGGGGGAA No data
Right 1006429163 6:33984544-33984566 CTCTGGGGACCACATTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006429153 Original CRISPR TTCCCCCAGCGCCCCTGGCC TGG (reversed) Intergenic
No off target data available for this crispr