ID: 1006430584

View in Genome Browser
Species Human (GRCh38)
Location 6:33993324-33993346
Sequence CTGAGTGAGTGGGAAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006430578_1006430584 5 Left 1006430578 6:33993296-33993318 CCAGTGGAGACAGGAACTGCGTT No data
Right 1006430584 6:33993324-33993346 CTGAGTGAGTGGGAAGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006430584 Original CRISPR CTGAGTGAGTGGGAAGTGGA AGG Intergenic
No off target data available for this crispr