ID: 1006434629

View in Genome Browser
Species Human (GRCh38)
Location 6:34019841-34019863
Sequence CCAGGCGTCCCTCCTGCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006434624_1006434629 -4 Left 1006434624 6:34019822-34019844 CCAAGCCAATTGTGAAGGGCCAG 0: 1
1: 0
2: 0
3: 11
4: 113
Right 1006434629 6:34019841-34019863 CCAGGCGTCCCTCCTGCCATGGG 0: 1
1: 0
2: 1
3: 21
4: 133
1006434626_1006434629 -9 Left 1006434626 6:34019827-34019849 CCAATTGTGAAGGGCCAGGCGTC 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1006434629 6:34019841-34019863 CCAGGCGTCCCTCCTGCCATGGG 0: 1
1: 0
2: 1
3: 21
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006434629 Original CRISPR CCAGGCGTCCCTCCTGCCAT GGG Intronic
900412672 1:2520026-2520048 CCGCGCGTGCCTCCTGCCATGGG - Intronic
902724984 1:18329512-18329534 CCAGGCTTCCCTCCTTGCCTGGG + Intronic
905013917 1:34764226-34764248 CCTGCCAACCCTCCTGCCATTGG - Intronic
906688873 1:47779699-47779721 CCATGGGCCCCTCCTGCCATGGG + Intronic
911266894 1:95753645-95753667 CAAGGCCTCCCTCCTGTGATCGG - Intergenic
917503032 1:175603336-175603358 CCAGGCATTCCTCCTCCCAAAGG + Intronic
920377412 1:205516653-205516675 CCAGGTGCCCCTCCTTCAATGGG - Intronic
923493102 1:234501684-234501706 CCATCCATCCCTCCTGGCATTGG - Intergenic
1062953424 10:1522906-1522928 AGAGGAGTCGCTCCTGCCATGGG - Intronic
1065626750 10:27637735-27637757 CCAGGAGTCCCTCAGGCCCTCGG - Intergenic
1067838288 10:49655140-49655162 CCACGCGTCCCTCCTGGAATCGG - Exonic
1070855857 10:79607613-79607635 CCAGGCTTCCATCTTGTCATTGG + Intergenic
1070920566 10:80183036-80183058 CCTGGTGCCCCTCCTGGCATGGG + Intronic
1072219418 10:93315234-93315256 CCAGGGGTCCCTCCTGGCAGAGG - Intronic
1074123473 10:110510242-110510264 CCCAGCCTCCCTCCTGCCAAGGG + Exonic
1074711633 10:116182914-116182936 CCATGCGTCCATCCAGCCAAAGG + Intronic
1074779624 10:116791847-116791869 ACAGGCTTCACTCCTGCCTTGGG + Intergenic
1075227664 10:120644283-120644305 CCTGGCTTCCCTCCTGGTATTGG + Intergenic
1076916879 10:133427394-133427416 CCAAGGGTGGCTCCTGCCATCGG + Intergenic
1078057693 11:8020410-8020432 ACAGGTGTCCCTCCTGCCTAAGG + Intronic
1084125552 11:67096704-67096726 CCCGGCCTCCCTGCTCCCATGGG - Intergenic
1084399699 11:68936511-68936533 CCTGGCCTCCCTCCTGCCGCTGG - Exonic
1089566026 11:119372307-119372329 CAAGGAGGCCCTCCTGCCACAGG + Intronic
1090805816 11:130201433-130201455 TCAGGCCTCCCTCCTGCTGTGGG - Intronic
1093900570 12:24626636-24626658 CTAGGCATCCCTCTTGCCATAGG - Intergenic
1096494064 12:52029177-52029199 GTATGCGTCCCTCCTGTCATTGG - Intronic
1096519782 12:52178412-52178434 CCAGGCTCCCCTCCTGCCTTAGG + Intronic
1103999120 12:124849205-124849227 CCAGGCTTCTCTCCAGCCTTTGG - Intronic
1104809579 12:131612236-131612258 CAAGGTGTCCTTCCTGCCACAGG + Intergenic
1104838682 12:131809221-131809243 CGACGCGTCCCTCCTGCCCTGGG - Intergenic
1104898075 12:132173906-132173928 CCATGTGTCCCTCCGGCAATGGG + Intergenic
1105890035 13:24676205-24676227 CCAGGCGGCCCTCCTCTCGTCGG + Intergenic
1109483235 13:62984573-62984595 CCAGGCCTGACTCCTCCCATTGG + Intergenic
1110377818 13:74814316-74814338 CTAGGCCTCCCTCCTGTGATGGG - Intergenic
1112771511 13:102799388-102799410 GCCGGCGTCCCTCGTCCCATCGG - Exonic
1113129908 13:107024122-107024144 CCTGGTGTTCCTCCAGCCATCGG + Intergenic
1115120258 14:29928585-29928607 TCAGACCTCCCTCCTGCCCTTGG - Intronic
1119897218 14:78230473-78230495 CCAGCCTTCTCTCCTTCCATAGG - Intergenic
1121314543 14:92953244-92953266 CCCGGCGTCCCTCCCGCTAGCGG + Intronic
1121937606 14:98034675-98034697 CCAGGCCTCACTCCTCCTATAGG - Intergenic
1124617308 15:31250975-31250997 ACAGGCAGCCCTTCTGCCATTGG - Intergenic
1126111109 15:45175294-45175316 CCGGGAGTCCCGCCTGCCAGAGG - Exonic
1127805222 15:62513116-62513138 CCAGCTGTCCTTCCTGCCTTAGG + Intronic
1127882515 15:63170509-63170531 CCAGGCGTCTTTGCTGCCTTTGG + Intergenic
1128337122 15:66794092-66794114 CCAGGCTACCCTCCCGCCATGGG - Intergenic
1129150434 15:73684658-73684680 GCGGGCGCCCCTCCTGCCCTGGG + Intronic
1129670571 15:77605687-77605709 CCAGCAGTCCCTCCTGCCTCTGG + Intergenic
1129845189 15:78764910-78764932 CCAGCCGTCCCTGCTCACATGGG + Intronic
1130256648 15:82328951-82328973 CCAGCCGTCCCTGCTCACATGGG - Intergenic
1130598303 15:85261037-85261059 CCAGCCGTCCCTGCTCACATGGG + Intergenic
1131152630 15:90056589-90056611 CAAGGCCACCATCCTGCCATGGG + Intronic
1133306599 16:4813460-4813482 CCAGGCCGCCCGCCTGGCATTGG - Intronic
1135950843 16:26912773-26912795 CCATGACTCCCTCCTGCCTTAGG - Intergenic
1136399604 16:30010374-30010396 CCAGGCCTCCCACCTGCCACCGG - Intronic
1141837974 16:86555156-86555178 CCAGGCCCCCCACCTGCCCTCGG + Exonic
1141921270 16:87137155-87137177 CCAGGCTGCCCTCCAGTCATTGG + Intronic
1142470465 17:160656-160678 CCAGGAGTCCCCCGTGCCACTGG - Intronic
1142887236 17:2920386-2920408 CCAGGCATGCCACCTGCCTTTGG + Intronic
1144675577 17:17159315-17159337 GCTCGCGCCCCTCCTGCCATCGG - Intronic
1144684441 17:17216607-17216629 CAAGCCCTCCCTCCTGCCAGAGG + Intronic
1152057234 17:78039608-78039630 CCAGCTGACCCTCCTGCCAGTGG + Intronic
1152097350 17:78279647-78279669 CCTGGAGTCCGGCCTGCCATAGG - Intergenic
1152184067 17:78843175-78843197 CCAGATGTCCCTCCTGCTCTAGG + Intergenic
1152666875 17:81575711-81575733 GCAGGCCTCCCTCCTGCCTTTGG + Intronic
1153493269 18:5671518-5671540 CCAGGCCTCAGTGCTGCCATGGG + Intergenic
1157550644 18:48579627-48579649 CCAGGCATCCCTGCTGCTCTAGG + Intronic
1160179316 18:76620262-76620284 CCCGGCCTCCCTCCTGAGATGGG - Intergenic
1160843728 19:1157539-1157561 CCACGCATCCCTCCAGTCATGGG - Intronic
1162036206 19:7941021-7941043 CCACCCCTCCCTCCTGCCAATGG + Intronic
1163790744 19:19304879-19304901 CTAGGTCGCCCTCCTGCCATGGG + Intronic
1164921227 19:32090091-32090113 CCAGGCGGCACTGCTGTCATGGG + Intergenic
1164936800 19:32221058-32221080 CCTGGCTTGCCTTCTGCCATGGG - Intergenic
924988426 2:290304-290326 CCAGGCGTCGCTCTTGCCCGTGG - Intergenic
925362797 2:3291126-3291148 CCAGGCATCCCTGCTGCTGTGGG - Intronic
925553381 2:5101250-5101272 CTAGGCTTTTCTCCTGCCATTGG + Intergenic
926224907 2:10960841-10960863 CCAGGCTTCCCTCCTGGGACCGG - Intergenic
931458586 2:62431739-62431761 CCAGGAGTCACTCCAGCCACCGG - Intergenic
934780552 2:96967076-96967098 CCAGCCCTCCCTCCAGCCAATGG + Intronic
935552957 2:104478141-104478163 CCAGGAGTCCCTCCTCTCACTGG - Intergenic
940918822 2:159286321-159286343 CCAGGCCTCCCTCTTGCCTGGGG - Intronic
943726943 2:191261600-191261622 GCAGGCGTCCCCTCTGCCACAGG - Intronic
944446708 2:199799077-199799099 CCAGGGTTCCCTCCTGCCTGGGG + Intronic
948709233 2:239815195-239815217 GCTGGCCTCCCTCCTGGCATGGG + Intergenic
948826955 2:240577504-240577526 CCAGGCGGCCCTCCTGCCCCTGG - Intronic
1169391980 20:5198041-5198063 CCCGGCTTTCCTCCTGCCCTTGG + Intergenic
1170605711 20:17873897-17873919 GAGGGTGTCCCTCCTGCCATGGG - Intergenic
1170942064 20:20856303-20856325 CCAGTCGTCCCTCCTCCAAGAGG - Intergenic
1172174796 20:32965839-32965861 CCAGGGGTCCTTCCTCCCAAGGG - Intergenic
1172863823 20:38079127-38079149 CCAAGCTTCCCCCGTGCCATAGG + Intronic
1172867207 20:38109492-38109514 CCTGGCCACCCTCCTGCAATTGG - Intronic
1174556265 20:51397697-51397719 CCAGGGCTTCCTTCTGCCATAGG + Intronic
1174565459 20:51461460-51461482 CCAGGCTTCCCTCCTGCCCCTGG + Intronic
1179730222 21:43363591-43363613 CCAGGCGCCCCTCCTGCAGCTGG + Intergenic
1180137343 21:45870460-45870482 CCCGGCCTCCCTGCTGCCCTAGG - Intronic
1181276199 22:21688695-21688717 CCAGGCTTTCCTGCTCCCATGGG + Intronic
1182280866 22:29217091-29217113 CCAGGCGGCCCCCATGCCCTGGG - Intronic
1182574849 22:31266237-31266259 CCAGGCCTCCTTCCTGGCTTTGG + Intronic
1182712532 22:32331830-32331852 CCTGGGGTTCCTCCTGCCACGGG + Intergenic
1183354072 22:37349263-37349285 CCAGGCCACCCTCATCCCATTGG - Intergenic
1183515125 22:38261119-38261141 ACAGCCGGCCCTCCTGCCTTTGG + Intronic
1183826500 22:40392120-40392142 CCAGGTGTCCCTCTTCACATGGG - Intronic
1184172617 22:42768822-42768844 TCAGGCCTCCATCCTGCCACTGG - Intergenic
1184340653 22:43884136-43884158 CCAGCCGCCCCTCCTGCCATGGG + Intronic
1184551853 22:45208951-45208973 CCAGGTCCCCCTCCTGCCAAAGG + Intronic
1185351668 22:50342927-50342949 CCGGGCCTCCCTCCTGCCACAGG - Intergenic
950967137 3:17154362-17154384 ACTGGCGTCCCTCCTGCCCAAGG - Intergenic
951522482 3:23622141-23622163 CCAGGCTTACCTCCTGCCCTGGG - Intergenic
954105070 3:48405547-48405569 CCAGGCGGGCTTCCTGGCATTGG - Intronic
954224121 3:49171795-49171817 CCAAGAGGCCCTCCTGCCAGGGG + Intronic
954285510 3:49616340-49616362 CCAGTAGTCCTTCCTGCCCTGGG + Intronic
954443313 3:50533543-50533565 CCAGGCGACCCTCCTGGCAGGGG + Intergenic
961268835 3:125672017-125672039 CCAAGCCTCCCCACTGCCATGGG + Intergenic
966891405 3:184409960-184409982 CCAGGCTTCCCTCCTGGAATAGG - Intronic
967266153 3:187694115-187694137 CCAGAGCTCCCTCCTGCCATTGG - Intergenic
967971527 3:195003127-195003149 CCAGGCCTCGCTCCTCCCACTGG - Intergenic
968022518 3:195405996-195406018 CCAGGCTTACCTCCAGCAATGGG + Intronic
969333379 4:6492833-6492855 ACAGGCCTCCCTCCTGCCAAAGG - Intronic
969516701 4:7652174-7652196 GCTGGCTTCCCTCCTGCCAGAGG + Intronic
969602161 4:8182894-8182916 CCAGGGTTCCCACCTGCCACTGG + Intronic
969703594 4:8780631-8780653 CCTGGGGTCCCTCCGGCCACAGG - Intergenic
974807533 4:66899548-66899570 CCAAGCCTCCCCTCTGCCATGGG - Intergenic
978489885 4:109301890-109301912 CCTGGCGGCCCTCCTGTCAGTGG - Exonic
980709356 4:136544089-136544111 CCAGGCCTCCTTCCTGATATTGG + Intergenic
985657873 5:1141418-1141440 CCAGCCGTCCCTGCTGCCACGGG + Intergenic
986304446 5:6504973-6504995 CCATGTGTCCCTCCTGTCACTGG - Intergenic
987353373 5:17041227-17041249 CTAGGCCTCCCTCCTGCAGTAGG - Intergenic
996823873 5:127659884-127659906 CCAGGCTGCACTCCTGCCTTCGG - Intergenic
1000057082 5:157616658-157616680 CTTGGTGTCCCTCCTGCCAAGGG - Intergenic
1001088384 5:168718421-168718443 CCAGGTGGCCCTCCTGCGACTGG + Intronic
1006434629 6:34019841-34019863 CCAGGCGTCCCTCCTGCCATGGG + Intronic
1006898814 6:37486972-37486994 CCAGGCTTCCCTGCTGCCCTTGG + Intronic
1007692477 6:43711612-43711634 GCAGGTTTCCCTCCTGCCCTGGG - Intergenic
1018457509 6:163964925-163964947 CCAGGGTGCCCTCCTGCCCTGGG + Intergenic
1019499101 7:1355514-1355536 CCAGGCTTCCCTCATGCCAGAGG - Intergenic
1019596812 7:1861907-1861929 CCAGGAGTCCCTCCAACCAGGGG - Intronic
1019797698 7:3063942-3063964 TCAGGCGATCCTCCTGCCACGGG + Intergenic
1024579768 7:50792770-50792792 CCAGGCGTCCCTGCAGCCCCGGG - Intronic
1030407092 7:109128724-109128746 CCTGGTGTCCCTCCAGTCATCGG - Intergenic
1031980054 7:128118979-128119001 ACAGGCCTCCCAGCTGCCATTGG + Intergenic
1035025396 7:155821689-155821711 ACCAGCGTCCCTCCTGCCTTGGG + Intergenic
1039397276 8:37237186-37237208 CCAGGTGACCGTCCTGCCCTAGG + Intergenic
1040000909 8:42575479-42575501 CCAAGCCTCCCTCCTTCCGTGGG + Intergenic
1043438585 8:80257259-80257281 CCAGGAGCCCCACCTGGCATTGG - Intergenic
1049342437 8:142120406-142120428 CCAGGCCTCTCTCCTGGCTTCGG + Intergenic
1049796283 8:144498644-144498666 TCTGGTGTGCCTCCTGCCATCGG + Intronic
1050265353 9:3883924-3883946 ACTGGCCTCCCTGCTGCCATGGG + Intronic
1050491610 9:6194542-6194564 CCAGGCATTCCTGCTCCCATTGG - Intergenic
1050894790 9:10872862-10872884 CCAGGCCCCCCTCCTGCTGTAGG - Intergenic
1056637406 9:88342724-88342746 CCAGCTGTCTCTCCTGCCTTTGG - Intergenic
1057803786 9:98206488-98206510 TCAAGTGCCCCTCCTGCCATAGG + Intronic
1057895341 9:98904452-98904474 TCTGGTGTCCCTCCTGCCAAAGG - Intergenic
1062402455 9:136378516-136378538 CCAGGGGTCCCTGCTGGCCTGGG + Exonic
1186389755 X:9147268-9147290 ACAGGCGGCCCTCCTGGCCTCGG + Intronic
1192218083 X:69177801-69177823 GCTGGCCTCCCTCCTCCCATAGG + Intergenic
1201017728 Y:9623256-9623278 CCAGGTGTCCTTCCTGCAGTTGG - Intergenic
1201592206 Y:15627851-15627873 CCAGGAGTCCCACATGCCCTGGG + Intergenic