ID: 1006435223

View in Genome Browser
Species Human (GRCh38)
Location 6:34022620-34022642
Sequence GTGAGCAACAGGAGGACGAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 230}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006435223_1006435232 7 Left 1006435223 6:34022620-34022642 CCCCTCGTCCTCCTGTTGCTCAC 0: 1
1: 0
2: 0
3: 21
4: 230
Right 1006435232 6:34022650-34022672 GCCCAGGCTGCCAGCAGTGATGG 0: 1
1: 0
2: 6
3: 46
4: 407
1006435223_1006435236 12 Left 1006435223 6:34022620-34022642 CCCCTCGTCCTCCTGTTGCTCAC 0: 1
1: 0
2: 0
3: 21
4: 230
Right 1006435236 6:34022655-34022677 GGCTGCCAGCAGTGATGGCTGGG 0: 1
1: 0
2: 1
3: 29
4: 252
1006435223_1006435229 -9 Left 1006435223 6:34022620-34022642 CCCCTCGTCCTCCTGTTGCTCAC 0: 1
1: 0
2: 0
3: 21
4: 230
Right 1006435229 6:34022634-34022656 GTTGCTCACCCGGTTTGCCCAGG 0: 1
1: 0
2: 0
3: 6
4: 57
1006435223_1006435238 14 Left 1006435223 6:34022620-34022642 CCCCTCGTCCTCCTGTTGCTCAC 0: 1
1: 0
2: 0
3: 21
4: 230
Right 1006435238 6:34022657-34022679 CTGCCAGCAGTGATGGCTGGGGG 0: 1
1: 0
2: 6
3: 59
4: 303
1006435223_1006435237 13 Left 1006435223 6:34022620-34022642 CCCCTCGTCCTCCTGTTGCTCAC 0: 1
1: 0
2: 0
3: 21
4: 230
Right 1006435237 6:34022656-34022678 GCTGCCAGCAGTGATGGCTGGGG 0: 1
1: 0
2: 8
3: 51
4: 413
1006435223_1006435235 11 Left 1006435223 6:34022620-34022642 CCCCTCGTCCTCCTGTTGCTCAC 0: 1
1: 0
2: 0
3: 21
4: 230
Right 1006435235 6:34022654-34022676 AGGCTGCCAGCAGTGATGGCTGG 0: 1
1: 0
2: 1
3: 28
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006435223 Original CRISPR GTGAGCAACAGGAGGACGAG GGG (reversed) Exonic
902060162 1:13635164-13635186 GTGGGCAACAAGATGAAGAGGGG + Intergenic
903803974 1:25990904-25990926 TTCAGCAACAGGAAGCCGAGAGG - Intronic
904992872 1:34607805-34607827 GGGAGCAGCAGGAGGAGGACTGG - Intergenic
905807106 1:40884880-40884902 GTGGGCATCAGGAGGCCCAGAGG + Intergenic
906192103 1:43905240-43905262 AAGAGGAACAGGAGGAGGAGGGG - Intronic
906192289 1:43905931-43905953 GAGAGGAGCAGGAGGAGGAGGGG - Intronic
906192432 1:43906437-43906459 GAGAGGAGCAGGAGGAGGAGGGG - Intronic
906192463 1:43906535-43906557 AAGAGGAACAGGAGGAAGAGTGG - Intronic
908887361 1:68804855-68804877 GAGAGCCACAGGAGGAACAGGGG + Intergenic
912073962 1:105849327-105849349 GTGAAAAACAGTAGGAAGAGAGG - Intergenic
912624880 1:111198701-111198723 GTCAGCAGGAGGAGGAGGAGCGG - Exonic
917971116 1:180208456-180208478 GTCAGCAAAAAGAGGAAGAGAGG - Intergenic
918002935 1:180514590-180514612 GGGAGGAAGAGGAGGAGGAGGGG + Intergenic
919067131 1:192706652-192706674 GTGAAACACAGGAGGAAGAGTGG + Intergenic
920364468 1:205440737-205440759 GTGGGCATGAGGAGGATGAGAGG + Intronic
921208634 1:212872791-212872813 GTGATCAACAGAAGGACAAAAGG - Exonic
921985219 1:221305499-221305521 GTGAGAAAGAGGAAGATGAGAGG + Intergenic
923369882 1:233299208-233299230 GTGAGAGAGAGGAGGATGAGAGG - Intergenic
924811578 1:247407542-247407564 GTGAGCAACAGCAGGAAGTGGGG - Intergenic
1062903799 10:1166268-1166290 GGGAGCAGCGGGAGGACCAGGGG + Intergenic
1063203551 10:3808580-3808602 GTGAGTTACTGGAGGAAGAGAGG + Intergenic
1064406494 10:15069015-15069037 GAGGGCAACAGGAGGAAGAGAGG - Intronic
1064984217 10:21193600-21193622 CTGAGCAACAGAAGGACAAAGGG + Intergenic
1065115619 10:22480013-22480035 GTCAGCAGCAGAAGGACCAGTGG + Intergenic
1065867348 10:29925587-29925609 GTGAGCACCAGGAGCACCAAAGG - Intergenic
1067590386 10:47503546-47503568 GTGTGGAACAGGAGGAGGAATGG + Intronic
1067637508 10:48011648-48011670 GTGTGGAACAGGAGGAGGAATGG + Intergenic
1067875985 10:50008686-50008708 GTGTGGAACAGGAGGAGGAATGG - Intronic
1069659645 10:70115170-70115192 GTGGCCACCAGGAGGAGGAGAGG + Intronic
1069941732 10:71961369-71961391 ATGAGCTACAGCAGGAAGAGAGG + Intergenic
1071522501 10:86339958-86339980 GGCAGCACCAGGAGGACGGGAGG + Intronic
1074818415 10:117162365-117162387 TTAAGCGACAGGAGGAAGAGAGG - Intergenic
1075817358 10:125275149-125275171 CTGAGCAACAGATGGACGAGTGG + Intergenic
1076324113 10:129607879-129607901 AAGAGCAAGAGGAGGACGTGGGG + Intronic
1076558412 10:131345241-131345263 GTTAGCAACAGGAGGGACAGTGG + Intergenic
1077213103 11:1382598-1382620 GAGAGCAGCGGGAGGACCAGAGG + Intergenic
1077280435 11:1742542-1742564 GGGAGCAGCAGGAGGAAGGGCGG + Intronic
1077557223 11:3231532-3231554 GTGAGCAGGAGGAAGAGGAGAGG + Intronic
1081540357 11:44030339-44030361 ATGAGAAACAGGAGGGAGAGTGG - Intergenic
1081810989 11:45914025-45914047 GGCAGCAACAGGAGGAGCAGGGG + Intronic
1082262528 11:50088274-50088296 GTGAGCAACAGGTGAATGAGGGG - Intergenic
1082710477 11:56548480-56548502 ATGAACAACATGAGGACTAGGGG - Intergenic
1082774458 11:57234888-57234910 GTCAGAAACAGGAGGACTCGGGG + Exonic
1083856285 11:65394586-65394608 GTGAGGAAAAGGAGGCTGAGGGG - Intronic
1084016994 11:66389718-66389740 GTGAGAAACAGGTGGATGAGTGG + Intergenic
1084087395 11:66860840-66860862 CTAAGCAACAGGAGGAGGTGGGG + Intronic
1084770408 11:71339461-71339483 GTGAGGAACAGGAGGGCCGGAGG - Intergenic
1084940969 11:72613150-72613172 GTGAGCCATAGGAGGACCTGTGG - Intronic
1085378295 11:76088345-76088367 ATGAGAAAAACGAGGACGAGGGG + Intronic
1087262321 11:96024804-96024826 GTGAGCAGAAGGAGAAGGAGTGG - Intronic
1088186321 11:107175746-107175768 GTGAGCCAAAGGAGGACTTGGGG - Intergenic
1091750741 12:3020003-3020025 GTGAGTGACAGGGTGACGAGAGG - Intronic
1091800691 12:3322940-3322962 GAGAGGGAGAGGAGGACGAGGGG + Intergenic
1091821506 12:3478997-3479019 GTGAGAAAGAGGAGGCCAAGGGG + Intronic
1091826204 12:3514672-3514694 GTGGGCGACAGGAGCACCAGTGG + Intronic
1091826210 12:3514695-3514717 GAGGGCAACAGGAGCACCAGTGG + Intronic
1092028091 12:5259808-5259830 GTGAGTAACAGAGGGAGGAGGGG + Intergenic
1092931018 12:13315837-13315859 GGAGGCAACAGGAGGAGGAGTGG - Intergenic
1095989515 12:48024986-48025008 GTGAGGAAGAGGAGGAGTAGAGG + Exonic
1096110582 12:49026945-49026967 GTGGGCGGCAGGAGGATGAGCGG - Exonic
1096258520 12:50077050-50077072 GTGAGAAACAGGTGGGAGAGGGG + Intronic
1098332758 12:69372028-69372050 GTGAACAAGAGGACGAGGAGTGG + Intronic
1101836203 12:108297154-108297176 CTGAGGAACAGGAAGAGGAGGGG - Intronic
1103509040 12:121461618-121461640 TTGAGCAACAGAAGAACAAGGGG + Intronic
1103896687 12:124277938-124277960 GTGAAGAAGAGGAGGAGGAGGGG - Intronic
1104129011 12:125874686-125874708 GTGAGAAACTGGAGCAAGAGGGG + Intergenic
1104301420 12:127568512-127568534 GTGAGAAAGAGGAGAAAGAGAGG + Intergenic
1104792781 12:131494164-131494186 GCGGGCATCAGGAGCACGAGGGG + Intergenic
1106216578 13:27707222-27707244 GAGAGCAAGAGGAGGGCAAGAGG + Intergenic
1106522091 13:30506877-30506899 GTGAGCACCATGAGAACTAGGGG - Intronic
1111306094 13:86414765-86414787 GAGAGCAAGGGGAGGAGGAGAGG - Intergenic
1113814476 13:113161758-113161780 CTGAGCAGGAGGAGGACGGGGGG - Intronic
1113814681 13:113162388-113162410 CTGAGCAGGAGGAGGATGAGGGG - Intronic
1113814750 13:113162598-113162620 CTGAGCAGGAGGAGGATGAGGGG - Intronic
1114565873 14:23632393-23632415 GAGAGCAACAGCAGGCAGAGTGG + Intronic
1114570848 14:23667246-23667268 GGGAGCAGCAGGGGGAGGAGAGG - Intergenic
1119180361 14:72600982-72601004 GAGAGGAAGAGGAGGAGGAGGGG + Intergenic
1122203790 14:100138188-100138210 GTGAGCAACAGCTGGACATGGGG + Intronic
1122357033 14:101129183-101129205 GAGAGCAACAGGAGCCCAAGGGG - Intergenic
1122541143 14:102498223-102498245 CTGAGGACCTGGAGGACGAGTGG + Exonic
1122643251 14:103174839-103174861 ATGAGCTACAGCAGGAAGAGAGG + Intergenic
1123025925 14:105424000-105424022 GTGAGCACCAGGAGCGGGAGTGG + Intronic
1202903349 14_GL000194v1_random:55473-55495 GTGAGGAACTGGAGGACGCGCGG - Intergenic
1125034420 15:35107259-35107281 GTGAGCAACAGCTGGACAACTGG - Intergenic
1127374344 15:58369298-58369320 CTGAGCACCAGGAGGAAGAGAGG - Intronic
1131436161 15:92423952-92423974 GTGAGGAACAGGATGACTTGGGG - Intronic
1131548273 15:93333776-93333798 GTCAGCAACAGGAGCAAGGGAGG - Intergenic
1132850443 16:2022703-2022725 GTGAGGAACAGGGGCAGGAGTGG - Intergenic
1132995342 16:2819714-2819736 GTGAGCTCCAGCAGGAGGAGAGG - Intronic
1134692060 16:16197595-16197617 GAGAGGAAGAGGAGGAGGAGGGG + Intronic
1135472522 16:22744052-22744074 GTGTGCAAGAGGAGGGCAAGAGG - Intergenic
1135516492 16:23139995-23140017 GTGAGGAAAAGGAGGAGGAAAGG - Intronic
1136558707 16:31025508-31025530 ATGGGAAACAGGAGGAAGAGTGG + Intergenic
1137536363 16:49329806-49329828 GTGAGCAACAGAAAGTCCAGGGG - Intergenic
1137590323 16:49689549-49689571 GTGACCTCCAGGAGGTCGAGGGG + Intronic
1137949647 16:52771494-52771516 GCCAGCCACAGGAGGAGGAGGGG + Intergenic
1138158694 16:54731783-54731805 GAGAGCAAAAGGAGGACTGGAGG - Intergenic
1139284271 16:65796926-65796948 GGGAGCAGGAGGAGGAGGAGAGG - Intergenic
1141155529 16:81594079-81594101 GGGAGGAAGAGGAGGAGGAGCGG - Intronic
1141673161 16:85503384-85503406 GTGAGGAGGAGGAGGAGGAGCGG - Intergenic
1141799579 16:86297736-86297758 GTGAGCCACAGGAGAAGGAAGGG - Intergenic
1144686919 17:17232203-17232225 GGGAGCAAGTGGAGGCCGAGTGG - Intronic
1144956714 17:19022299-19022321 GTGGGCAGCAGGAGGCCCAGTGG - Intronic
1146185267 17:30720341-30720363 GAGAGCGACAGGAGGAGAAGTGG - Intergenic
1147043691 17:37737140-37737162 GTGAGGAGAAGGAGGAAGAGGGG - Intronic
1147267586 17:39244267-39244289 AGGAGCAGCAGGAGGAGGAGGGG - Intergenic
1147538910 17:41340221-41340243 GAGAAGAAGAGGAGGACGAGGGG - Intergenic
1148069936 17:44902756-44902778 GTGGGCTCCAGGAGGAGGAGAGG + Exonic
1149544055 17:57489929-57489951 GTGAGCAGGAGGGTGACGAGAGG + Intronic
1150345087 17:64398428-64398450 CTGAGCAACTGGAGGTGGAGTGG + Intronic
1151348760 17:73519247-73519269 GTGGGCAAGAGGAGGAACAGGGG - Intronic
1152587233 17:81194507-81194529 GTGAGCCACAGGAGGAGGCAGGG - Intronic
1152979565 18:263458-263480 GTGTACAGCAGGAGGAGGAGAGG - Intronic
1153680654 18:7497390-7497412 GGGAGGAAGAGGAGGAAGAGGGG + Intergenic
1153704529 18:7732253-7732275 GTGATGAACAGTAGGGCGAGGGG + Intronic
1155258041 18:24015124-24015146 GTGACCGACAGGAGGGGGAGGGG - Intronic
1155442414 18:25876040-25876062 ATAAACAGCAGGAGGACGAGTGG + Intergenic
1156604203 18:38646477-38646499 CTAAGCAACTGGAGGAAGAGTGG + Intergenic
1157028739 18:43878720-43878742 TTGAGTAACAGGAGTACAAGAGG + Intergenic
1158938173 18:62384280-62384302 GGGAGGAAAAGGAGGAGGAGAGG - Intronic
1158938199 18:62384364-62384386 GGGAGGAAGAGGAGGAGGAGAGG - Intronic
1159491867 18:69147100-69147122 GGGAGGAAGAGGAGGAAGAGGGG - Intergenic
1160306623 18:77745759-77745781 GAGAGCAACAGGAACACAAGGGG + Intergenic
1160554129 18:79715052-79715074 GTGGGCAGGAGGAGGGCGAGCGG + Exonic
1161279361 19:3436970-3436992 GGGAGCTACAGGAGGAGGAAGGG + Intronic
1162901134 19:13795959-13795981 GACAGAAACAGGAGGATGAGGGG - Intronic
1162973509 19:14195348-14195370 GAGAGCAACAGGAGGAGAAGCGG + Intronic
1164292732 19:23882023-23882045 GAGAGCAGAAGGAGGAAGAGAGG + Intergenic
1167081613 19:47279926-47279948 GAGAGCAAGAGGAGGAGGTGAGG + Intergenic
1168072203 19:53959492-53959514 GTGCGGAGCTGGAGGACGAGAGG - Intergenic
925148611 2:1599800-1599822 GGGAGCAGCAGGAAGAGGAGGGG - Intergenic
930095431 2:47562763-47562785 GTGAGGAACAGGGGGTGGAGGGG - Intronic
932356412 2:71071702-71071724 GTGGGGACCAGGAGGACGCGGGG + Exonic
934503321 2:94874949-94874971 GTGAGGAGCTGGAGGACGCGCGG + Exonic
934554716 2:95281273-95281295 GCGAACACCAGGAGGATGAGGGG - Exonic
935831875 2:107008714-107008736 CTGAGCAACAGTAGGAGAAGAGG + Intergenic
939538484 2:143462991-143463013 CTGGGCCACAGGAGGACTAGGGG - Intronic
941641800 2:167996852-167996874 GTGAGCCTGAGGAGGACAAGGGG + Intronic
944311510 2:198238850-198238872 GTGAGCAACTGGAGGGCTGGAGG + Intronic
945142316 2:206699814-206699836 GGGAGCCACAGGAGGATGGGAGG + Exonic
945159448 2:206874245-206874267 ATGAGCATCAGGAGGACAGGTGG - Intergenic
946280585 2:218663062-218663084 GGGAGGAACAGGAGGTCGAGGGG + Intronic
947605885 2:231484850-231484872 CTGAGGAAGAGGAGGAGGAGGGG - Intergenic
948719608 2:239890580-239890602 GTGAGCACCAGGAGCAAGAGAGG - Intergenic
948965972 2:241380845-241380867 GTCAGAATCAGGAGGAGGAGTGG + Intronic
1169129126 20:3154826-3154848 GTGAGTAAGAGGAGGAGTAGGGG + Intronic
1175589540 20:60177690-60177712 GGGAGATACAGGAGGACCAGAGG + Intergenic
1175639220 20:60613531-60613553 GGGAGGAACAGGGGGATGAGAGG + Intergenic
1176622714 21:9070241-9070263 GTGAGGAACTGGAGGACGCGCGG - Intergenic
1177856215 21:26403618-26403640 GTGAGGAGGAGGAGGAGGAGAGG - Intergenic
1180075425 21:45459280-45459302 GTGAGGGGCAGGAGGAGGAGGGG + Intronic
1180709100 22:17827678-17827700 GTGAGAGAGAGGAGGAAGAGAGG - Exonic
1181277692 22:21696915-21696937 GTGTGCAGCAGGGTGACGAGGGG - Exonic
1181323454 22:22026088-22026110 GTGAGAAGCTGGAGGAGGAGAGG - Intergenic
1181343672 22:22201687-22201709 GAGAGGAGCAGGAGGAGGAGAGG - Intergenic
1181362970 22:22352952-22352974 GAGAGGAACAGGAGAAGGAGAGG - Intergenic
1181365775 22:22376026-22376048 GAGAGGAACAGGAGGAGGAGAGG - Intergenic
1181517254 22:23422082-23422104 GGGAGCAAAAGGAAGAGGAGTGG - Intergenic
1181838967 22:25638064-25638086 ATGAGCACCAGGATGACAAGGGG - Intronic
1183248542 22:36712024-36712046 GTGGGCAACAGGATGGGGAGAGG + Intergenic
1183672026 22:39278549-39278571 GTGAGCAACAGGACGCGGTGAGG + Intergenic
1184379517 22:44136335-44136357 AAGAGCAACAGGAGAAGGAGGGG - Intronic
1185245110 22:49769348-49769370 GTGAGCATCTGGAGGAAGGGAGG - Intergenic
950575969 3:13832239-13832261 GGGAGCAAGAGGAGGAGGAGGGG - Intronic
950586433 3:13895583-13895605 GTGAGAAGCCGGAGGCCGAGAGG + Intergenic
950797253 3:15520312-15520334 GTGAGAAACAGAAGGAGGTGGGG - Intronic
951168724 3:19513025-19513047 ATGAGGAAGAGGAGGAGGAGGGG + Exonic
951698149 3:25467413-25467435 GTGAGCAACAACAGGGGGAGAGG - Intronic
954411549 3:50373452-50373474 GTGAGCCACAGGCAGAGGAGTGG + Intronic
960949266 3:122988503-122988525 GACAGCAGCAGGAGGAAGAGAGG + Intronic
962201072 3:133401649-133401671 GAGAGAAAGAGGAGGAGGAGAGG - Intronic
963052952 3:141158052-141158074 GTGAGCAACTGGAGGCAGAAGGG + Intergenic
966370641 3:179247910-179247932 AAGAGCAACAGGAGGCCCAGGGG - Intronic
967444085 3:189544543-189544565 GTGAGCAAGAGCAGCAAGAGCGG + Intergenic
967886383 3:194336499-194336521 GTGGTCAACAGGAGGACATGGGG - Intergenic
969070753 4:4536638-4536660 GTGAGCAAAAGGAGGGGGAGAGG + Intronic
969339072 4:6529121-6529143 GGGGGCAGCTGGAGGACGAGGGG + Intronic
970158707 4:13167633-13167655 GTGAGGAGCAGCAGGAGGAGAGG + Intergenic
972479863 4:39486892-39486914 GTGTGTTATAGGAGGACGAGAGG + Intergenic
974846837 4:67361563-67361585 ATGAGCAACAGGAGTACCACAGG - Intergenic
975814706 4:78205723-78205745 GGGAGCAGCAGCAGGAAGAGGGG + Intronic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
976679506 4:87739565-87739587 GTGAGGAACAGGAGGAAAAGTGG - Intergenic
977898127 4:102386803-102386825 GTGAAGAACAGGAGAAGGAGAGG - Intronic
981128476 4:141132896-141132918 GTGAGCAGCAGCAGGAGGAGAGG - Intronic
984623674 4:181981077-181981099 GGGAACCACAGGAGGAGGAGAGG - Intergenic
984695133 4:182771366-182771388 GTGATCTACAGGAGGGCTAGTGG + Intronic
986245287 5:6001404-6001426 GTGAGCTCCTTGAGGACGAGGGG + Intergenic
988730057 5:33963475-33963497 GTAAGAGACAGGAGGACCAGAGG + Intronic
991968459 5:72114814-72114836 GAGAGGAACAGGAGGGCAAGAGG - Intronic
995175727 5:109174193-109174215 GTGAGGAACAGTATGATGAGTGG + Intronic
997606157 5:135177074-135177096 GTCAGCAGCAGGCTGACGAGTGG + Intronic
999495389 5:152091454-152091476 GGGAGCAAGAGGAGGACATGTGG + Intergenic
1001310034 5:170603933-170603955 GGGAGAAACAGGAGGTGGAGGGG + Intronic
1001852499 5:174981699-174981721 TTTAGCAGCAGGAGGAAGAGGGG - Intergenic
1004573826 6:16873545-16873567 GTGAGAAACAGGAGGAGGATGGG + Intergenic
1006151187 6:31991124-31991146 GAGAGGGACAGGAGGACAAGTGG - Intronic
1006157488 6:32023862-32023884 GAGAGGGACAGGAGGACAAGTGG - Intronic
1006316171 6:33293156-33293178 GGGAGCCACAGGAGGCTGAGCGG + Exonic
1006435223 6:34022620-34022642 GTGAGCAACAGGAGGACGAGGGG - Exonic
1006889941 6:37418160-37418182 GTGTGCACCTGGAGGAAGAGGGG + Intergenic
1010605190 6:77880695-77880717 GTGTGCAGCAGGAGGATGGGTGG - Intronic
1011625330 6:89278862-89278884 GGGAGGAAGAGGAGGACGGGAGG + Intronic
1014024665 6:116631518-116631540 GAGACCAAGAGGAGGATGAGAGG + Intronic
1014289301 6:119539835-119539857 ATGGACAACAGGAGGACCAGTGG + Intergenic
1015118412 6:129675126-129675148 TTGAGAAACAGAAGGACAAGTGG + Intronic
1016030543 6:139332955-139332977 GTTACCAACATGAGGAAGAGTGG + Intergenic
1019551799 7:1606823-1606845 GGGAAGAAGAGGAGGACGAGAGG - Intergenic
1019612566 7:1944413-1944435 GTGAGAAACAGCAGGAAGCGTGG + Intronic
1024142651 7:46477802-46477824 GTGAGGAACAGGAAGAGAAGAGG + Intergenic
1025044086 7:55677639-55677661 GTAAGCAAAAGGAGGTCGAAGGG - Intergenic
1025137009 7:56426159-56426181 GTAAGCAAAAGGAGGTCGAAGGG - Intergenic
1029657171 7:101934935-101934957 GTGAGGAGCAGGAGGAGGAAGGG + Intronic
1031549786 7:123094717-123094739 CTGAGGGACAGGAGGAAGAGAGG + Intergenic
1032017564 7:128389561-128389583 GGGACCAAGAGGAGGAGGAGTGG - Intergenic
1032548998 7:132766887-132766909 GTGAGCTGCAGCAGGAGGAGGGG + Intergenic
1033674147 7:143521081-143521103 TTGAGCAACAGGAAGTGGAGAGG + Intergenic
1034277630 7:149830601-149830623 GGGAGGCACAGGAGGAGGAGGGG - Intergenic
1034400709 7:150859813-150859835 CTGAGGAAGAGGAGGAGGAGGGG + Intronic
1035041905 7:155935180-155935202 GTGAGGAAGAGGAGGAGGAGGGG - Intergenic
1035280618 7:157776052-157776074 GGGAGGAAGAGGAGGAGGAGAGG - Intronic
1036674456 8:10818597-10818619 GTGAGCAGCAGGCAGAAGAGAGG + Intronic
1037182050 8:16018955-16018977 GTGGGCTACAGGAGGTGGAGAGG - Intergenic
1037886605 8:22599256-22599278 GCGAGGAAGAGGAGGGCGAGGGG - Intronic
1039466621 8:37789242-37789264 GGGAGGAACAGGAGGAGGAAGGG + Intronic
1042014920 8:64298376-64298398 GTGAGTAACAGAAGCAAGAGAGG + Intergenic
1044058493 8:87602537-87602559 GTGAGGAAAAGGTGGATGAGGGG - Intronic
1044417962 8:91957438-91957460 GAGAGGAAGAGGAGGAAGAGGGG + Intronic
1045488974 8:102655254-102655276 GTGAGGAGGAGGATGACGAGCGG - Intronic
1045614842 8:103897513-103897535 TTGAGCATCAGTAGGACCAGAGG - Intronic
1046451848 8:114402924-114402946 GAGAGGAAGAGGAGGAGGAGGGG - Intergenic
1051649104 9:19302722-19302744 GTGAGCAAGAGGAAGAGGAGTGG - Intronic
1054453527 9:65416950-65416972 CTAAGTAACAGAAGGACGAGGGG + Intergenic
1060489434 9:124071711-124071733 GGGAGGAAGAGGAGGAAGAGGGG - Intergenic
1060492819 9:124097437-124097459 GTGAGCAGAAGGTGGAGGAGAGG + Intergenic
1060498126 9:124132858-124132880 GTGAGGACCAGGAGCAGGAGGGG + Intergenic
1061127216 9:128684546-128684568 CTGAGCACCTGGAGGACGCGGGG - Intronic
1061778835 9:132984208-132984230 GTGAGCAGGAGGAGGACTGGGGG - Intronic
1203745905 Un_GL000218v1:40669-40691 GTGAGGAACTGGAGGACGTGCGG - Intergenic
1185601339 X:1341763-1341785 GTGAGCCAAAGGAGGACCATCGG - Exonic
1185609390 X:1385549-1385571 GGGAGCTACAGGAGGTGGAGAGG + Intergenic
1185662056 X:1735655-1735677 GAGAGAAAGAGGAGGAGGAGGGG - Intergenic
1188758327 X:33993146-33993168 GTGAGCAGCAGATGGATGAGTGG - Intergenic
1188927426 X:36061887-36061909 GTGAACAACAGGTGAAGGAGAGG - Intronic
1191896135 X:65995316-65995338 GTGAGCAACTAGAGGAGGTGGGG + Intergenic
1194504054 X:94710655-94710677 GATAGCAACTGGAGGATGAGTGG + Intergenic
1195107655 X:101616498-101616520 GTGAGAAGCTGGAGGAGGAGGGG - Exonic
1195941465 X:110171405-110171427 GTAAGCACCTGGAGGAAGAGGGG - Exonic
1198033209 X:132775397-132775419 GAGAGGAACTGGAGGAAGAGCGG - Intronic
1198516817 X:137417014-137417036 GTGAACAACAGGAACAAGAGGGG - Intergenic
1200936729 Y:8744821-8744843 GTGAGCCCCAGGAGGAAGGGAGG - Intergenic
1201159230 Y:11155681-11155703 GTGAGGAACTGGAGGACGCGCGG - Intergenic