ID: 1006435439

View in Genome Browser
Species Human (GRCh38)
Location 6:34023634-34023656
Sequence CTTACTCCACACCAGGACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 149}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006435424_1006435439 6 Left 1006435424 6:34023605-34023627 CCCCCTTTTCTGCCCCTGTCCCT 0: 1
1: 0
2: 8
3: 149
4: 1092
Right 1006435439 6:34023634-34023656 CTTACTCCACACCAGGACTGGGG 0: 1
1: 0
2: 2
3: 15
4: 149
1006435420_1006435439 30 Left 1006435420 6:34023581-34023603 CCCCTGTCTCTCTCAGTCTTGAG 0: 1
1: 0
2: 3
3: 35
4: 460
Right 1006435439 6:34023634-34023656 CTTACTCCACACCAGGACTGGGG 0: 1
1: 0
2: 2
3: 15
4: 149
1006435423_1006435439 7 Left 1006435423 6:34023604-34023626 CCCCCCTTTTCTGCCCCTGTCCC 0: 1
1: 0
2: 8
3: 99
4: 901
Right 1006435439 6:34023634-34023656 CTTACTCCACACCAGGACTGGGG 0: 1
1: 0
2: 2
3: 15
4: 149
1006435425_1006435439 5 Left 1006435425 6:34023606-34023628 CCCCTTTTCTGCCCCTGTCCCTC 0: 1
1: 2
2: 10
3: 100
4: 847
Right 1006435439 6:34023634-34023656 CTTACTCCACACCAGGACTGGGG 0: 1
1: 0
2: 2
3: 15
4: 149
1006435431_1006435439 -8 Left 1006435431 6:34023619-34023641 CCTGTCCCTCTGGCCCTTACTCC 0: 1
1: 0
2: 3
3: 31
4: 425
Right 1006435439 6:34023634-34023656 CTTACTCCACACCAGGACTGGGG 0: 1
1: 0
2: 2
3: 15
4: 149
1006435422_1006435439 28 Left 1006435422 6:34023583-34023605 CCTGTCTCTCTCAGTCTTGAGCC 0: 1
1: 0
2: 1
3: 26
4: 207
Right 1006435439 6:34023634-34023656 CTTACTCCACACCAGGACTGGGG 0: 1
1: 0
2: 2
3: 15
4: 149
1006435430_1006435439 -7 Left 1006435430 6:34023618-34023640 CCCTGTCCCTCTGGCCCTTACTC 0: 1
1: 0
2: 3
3: 43
4: 381
Right 1006435439 6:34023634-34023656 CTTACTCCACACCAGGACTGGGG 0: 1
1: 0
2: 2
3: 15
4: 149
1006435427_1006435439 3 Left 1006435427 6:34023608-34023630 CCTTTTCTGCCCCTGTCCCTCTG 0: 1
1: 1
2: 5
3: 108
4: 943
Right 1006435439 6:34023634-34023656 CTTACTCCACACCAGGACTGGGG 0: 1
1: 0
2: 2
3: 15
4: 149
1006435421_1006435439 29 Left 1006435421 6:34023582-34023604 CCCTGTCTCTCTCAGTCTTGAGC 0: 1
1: 0
2: 1
3: 33
4: 302
Right 1006435439 6:34023634-34023656 CTTACTCCACACCAGGACTGGGG 0: 1
1: 0
2: 2
3: 15
4: 149
1006435429_1006435439 -6 Left 1006435429 6:34023617-34023639 CCCCTGTCCCTCTGGCCCTTACT 0: 1
1: 0
2: 3
3: 40
4: 486
Right 1006435439 6:34023634-34023656 CTTACTCCACACCAGGACTGGGG 0: 1
1: 0
2: 2
3: 15
4: 149
1006435426_1006435439 4 Left 1006435426 6:34023607-34023629 CCCTTTTCTGCCCCTGTCCCTCT 0: 1
1: 0
2: 7
3: 89
4: 938
Right 1006435439 6:34023634-34023656 CTTACTCCACACCAGGACTGGGG 0: 1
1: 0
2: 2
3: 15
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006435439 Original CRISPR CTTACTCCACACCAGGACTG GGG Intronic
900638897 1:3678921-3678943 CTTCCTCCACGCCAGGAGTTGGG - Intronic
902617732 1:17632982-17633004 CTCACCCCACACCAGGGCTCCGG - Intronic
904825528 1:33271571-33271593 CTGTCGCCTCACCAGGACTGTGG - Intronic
908458380 1:64326212-64326234 GCTGCTCCACACCAGGAATGTGG + Intergenic
909562833 1:77024788-77024810 TTTGCTCCAGAGCAGGACTGTGG - Intronic
913071976 1:115307467-115307489 CTTCCTCCTCACCAGAGCTGAGG - Intronic
916850529 1:168698573-168698595 CTGATTTCACACCAGGACAGTGG + Intronic
919039867 1:192371797-192371819 CTGACTCCACAACTAGACTGGGG - Intergenic
919054979 1:192559320-192559342 CTTTCTCCACATCAGCAGTGAGG + Intergenic
919564283 1:199164485-199164507 CATACTCCACACGAGAGCTGAGG - Intergenic
922569887 1:226628205-226628227 CTTGCTCTCCAGCAGGACTGGGG - Intergenic
923200618 1:231707356-231707378 CTGCCTGCACACCAGGACTTTGG + Intronic
923225276 1:231933522-231933544 CTCACACCACACCAGGCATGTGG - Intronic
923358711 1:233186433-233186455 CTTACTTCACACACGGCCTGCGG + Intronic
923761341 1:236847922-236847944 CTTACTCCTCACCAGGGCTGTGG - Intronic
1063383130 10:5598932-5598954 CTTTCTCCACCCAAAGACTGTGG - Intergenic
1064218337 10:13418808-13418830 CTTCCCCCACACCAGGACAACGG + Intergenic
1066531209 10:36341666-36341688 CTTTCTCCATACCAGCAATGAGG - Intergenic
1067832067 10:49616036-49616058 CCTACTCCACACCAGAGATGTGG + Intronic
1068404841 10:56575044-56575066 ATGACTCAACAACAGGACTGAGG - Intergenic
1069813944 10:71181566-71181588 CTTGCCCCACACCAGGTCTGGGG - Intergenic
1072223856 10:93349891-93349913 CACACTCCACAACAAGACTGGGG + Exonic
1077005990 11:356275-356297 CTTCCTCCACAGCAGGGCCGGGG + Intergenic
1078392001 11:10943277-10943299 CCTACTTTACACCAGCACTGAGG - Intergenic
1078447066 11:11412347-11412369 CATAGTCCAAACCAGGTCTGGGG - Intronic
1078763021 11:14266829-14266851 AGTGCTCCACACCAGGGCTGTGG + Exonic
1083274835 11:61591020-61591042 CTCCCTCCACTCCAGGTCTGAGG + Intergenic
1087307640 11:96504266-96504288 TTTCCTGCACACCAGGCCTGAGG + Intronic
1087374571 11:97325737-97325759 CTTACCCCCCACCAGCACAGTGG - Intergenic
1088576099 11:111272741-111272763 CCTACTCTGCACCAGGATTGTGG - Intronic
1091344586 11:134844239-134844261 CTCACCCCAGACCAGGGCTGTGG + Intergenic
1093029173 12:14272293-14272315 CTTTCTCTACACCTGAACTGAGG + Intergenic
1093065197 12:14650997-14651019 ATTACTCCACTCTTGGACTGAGG - Intronic
1093509935 12:19914669-19914691 CTTACTCCAGCATAGGACTGGGG - Intergenic
1096409776 12:51368813-51368835 CTTACTTAACTCCAGGAATGAGG + Intronic
1099418850 12:82427216-82427238 CTTATTCCATACAAGGAATGTGG - Intronic
1100890347 12:99118969-99118991 TTTACTTCACACCAGCACTCAGG + Intronic
1102897768 12:116612236-116612258 CTTTCTGTACACCAGGCCTGGGG + Intergenic
1103029102 12:117597961-117597983 CTTTCTCAACACGAGGAGTGGGG + Intronic
1104042417 12:125139194-125139216 CTTACTCAACACAAGGAGTGTGG - Intronic
1106076130 13:26462670-26462692 CTTGCTCCTCCCCAGAACTGAGG - Intergenic
1109683192 13:65780223-65780245 CTTACTACAAGTCAGGACTGCGG + Intergenic
1112246855 13:97743169-97743191 CTTCCACAAGACCAGGACTGGGG + Intergenic
1114647561 14:24264052-24264074 CTTACTCCACCCCGTCACTGGGG + Intronic
1118763100 14:68892553-68892575 CTAACTTCACACCAGGTCTATGG - Intronic
1119062039 14:71484993-71485015 CTTACTCCATCCCAGCCCTGTGG + Intronic
1122078022 14:99247991-99248013 TTTTCTCCACACCAGGAGTGGGG + Intronic
1122984261 14:105205060-105205082 CAAACTCCACACTAGGACAGGGG + Intergenic
1128668685 15:69558137-69558159 CTTAATCCACTCCAGAGCTGAGG + Intergenic
1129065574 15:72901288-72901310 CCTACTCCACCCAAGCACTGGGG - Intergenic
1131784379 15:95896107-95896129 ATTAGTCCACACCAGGCCTGAGG + Intergenic
1132216070 15:100062458-100062480 CTAACTCTTCAACAGGACTGTGG + Intronic
1138592841 16:58011773-58011795 ATTCCTCCAGGCCAGGACTGTGG + Intronic
1139568945 16:67798417-67798439 GGTCCTCCACACCAGGAATGTGG + Intronic
1140508694 16:75491927-75491949 CACTCTCAACACCAGGACTGTGG + Intronic
1141326058 16:83060468-83060490 CTTACTCCAAACCAGGACTTAGG + Intronic
1141739910 16:85884246-85884268 CTCACTTCACACCAGCACTCTGG + Intergenic
1142396102 16:89832564-89832586 CTGACTCCTCACCAGAGCTGAGG + Intronic
1143192433 17:5049792-5049814 CTTGCCCCACACCAGAACAGAGG - Intronic
1143544399 17:7588010-7588032 CTTCCCCCACCCCAGCACTGGGG - Exonic
1144521933 17:15958549-15958571 CCTACTCCCCACCTGGTCTGGGG + Intronic
1145935564 17:28712708-28712730 CAAACACCACACCTGGACTGTGG + Intergenic
1148754040 17:49963207-49963229 CTCCCCCCACACCAGGCCTGGGG + Intergenic
1149302565 17:55318535-55318557 CTTACACCACATCAAGCCTGTGG + Intronic
1150776868 17:68088049-68088071 CTGACTCCACTCCAGTACTTTGG + Intergenic
1151604705 17:75129081-75129103 CTGCGTCCACATCAGGACTGTGG - Exonic
1152064318 17:78102117-78102139 CTGATTCCACACCGGGTCTGGGG + Intronic
1152066485 17:78115327-78115349 CATGCTCCACACCAGGGCTAGGG - Intronic
1153413899 18:4824362-4824384 CTGGCTCCACACTAGGAATGTGG - Intergenic
1156312564 18:35938190-35938212 CTTTCTCCAGAGCAGGACAGTGG - Intergenic
1157426859 18:47591619-47591641 CTTCCACCACAGCAGGGCTGGGG - Intergenic
1159872003 18:73768852-73768874 CTTAAGCCAGACCAGGACAGTGG + Intergenic
1160050449 18:75428505-75428527 TTTACTCAACACCAACACTGTGG - Intergenic
1160189357 18:76702910-76702932 GTTATTCCACACCGGGACAGAGG + Intergenic
1160710155 19:547694-547716 CTCTGTCCACACCAGGACTGTGG - Intronic
1161618672 19:5286835-5286857 CAAGCCCCACACCAGGACTGAGG + Intronic
1161618683 19:5286879-5286901 CAAGCCCCACACCAGGACTGAGG + Intronic
1167698324 19:51027603-51027625 CTTGCTCCACACCTGGTCAGGGG - Exonic
1168268755 19:55238332-55238354 CTTAGTCCACAGCTGGACAGAGG - Intronic
1168358155 19:55715159-55715181 CTTACTGCACAAGAGGACTTCGG + Exonic
926712390 2:15891675-15891697 CTCTCTCCACCCCAGGCCTGCGG - Intergenic
926782775 2:16490527-16490549 TTTGCTCCACACCTGGACGGTGG - Intergenic
933118882 2:78510374-78510396 CTGACTCCACCCCAGCACTGTGG - Intergenic
933658297 2:84906461-84906483 CTTCCTCCACATCACGACTGGGG - Exonic
936749196 2:115620366-115620388 CTTACTCCACACTTGCAGTGAGG - Intronic
937264397 2:120606920-120606942 CCTACCACCCACCAGGACTGAGG + Intergenic
937684824 2:124683956-124683978 CTTTCTCCGCACAAGGCCTGGGG + Intronic
941501798 2:166288285-166288307 CTTTTTCCACACCAGAAATGAGG + Intronic
941568372 2:167138314-167138336 ATAACTCCATTCCAGGACTGAGG + Intronic
943634327 2:190288822-190288844 CTTACACCACACCAGGTGCGTGG + Intronic
948048535 2:234961929-234961951 CACACTCCACCCCAGGTCTGGGG - Intronic
948052877 2:234991826-234991848 CTCCCTCCACTCCAGCACTGAGG + Intronic
948168584 2:235882302-235882324 CTTCCTCCACATCACAACTGGGG + Intronic
1169072026 20:2738608-2738630 CTTTCCCCAAACCAGGCCTGAGG - Intronic
1170552299 20:17488582-17488604 CCTGCTCCACACGAGGTCTGGGG - Intergenic
1174560442 20:51427231-51427253 CTGACTCCACAGCTGAACTGGGG - Intronic
1174918683 20:54679499-54679521 CTTACTGCAAACCAGGGCTTGGG + Intergenic
1175565878 20:59976706-59976728 CCTCCCCCACAGCAGGACTGAGG - Intronic
1178410892 21:32362924-32362946 CTTACTCTGCACAAGGACTTTGG + Intronic
1179947388 21:44687435-44687457 CGGAATCCACACCAGCACTGAGG + Intronic
1181940399 22:26471352-26471374 CTGACTCCATACAAGGAATGTGG - Intronic
1182434749 22:30323251-30323273 ATTACTCCACCGCAGGCCTGAGG + Intronic
1184795679 22:46731212-46731234 CTTACTCCACTCCAGCAAGGAGG - Intronic
1185045100 22:48524772-48524794 TTTACTCTGCACCAGGAGTGGGG + Intronic
1185128068 22:49022734-49022756 CTTTCTCCACACCAAGGCTGTGG - Intergenic
951440326 3:22715327-22715349 CTTACTCCAGTCCAACACTGAGG - Intergenic
954796329 3:53162993-53163015 CTCACTCCACAGCAGGAACGAGG - Intronic
954796937 3:53166264-53166286 CTTCCTCCACACCAGGTTTAGGG - Intronic
956623982 3:71248881-71248903 AGGACTCCACACCAGGCCTGAGG - Intronic
957440587 3:80241788-80241810 ATTACTCTACATCAGGCCTGAGG + Intergenic
961043778 3:123695019-123695041 CTTACTCCACCACAGCCCTGAGG - Intronic
962106345 3:132394467-132394489 CTGACTCCAACCCAGGACTTGGG + Intergenic
962461368 3:135616452-135616474 CTTTCTCCAGACCAGGAATGAGG + Intergenic
962733636 3:138304955-138304977 CCTGATCCTCACCAGGACTGAGG - Exonic
967501313 3:190201376-190201398 TTTACTCCACTGCAGAACTGTGG - Intergenic
971255328 4:25008924-25008946 CTTCCTCCCCACCAGCTCTGTGG + Intronic
971460112 4:26886628-26886650 CTTACTCTACACCAGCCCTGTGG - Intronic
975034958 4:69668764-69668786 CTCACTCCACAGCAGCAGTGTGG + Intergenic
980167011 4:129241074-129241096 CTGACTTCTCACCAGGAATGGGG + Intergenic
982753461 4:159190765-159190787 CTAACACCAGAACAGGACTGGGG + Intronic
983899932 4:173122855-173122877 CTTACTCCACTTCAGGCCTTGGG - Intergenic
985337880 4:188915531-188915553 CTTCCTTCACACCAGGGCTTCGG - Intergenic
985923843 5:3000449-3000471 CTTCCTCCACACCATCACTGAGG + Intergenic
991095030 5:62730971-62730993 CATACCCCACCCCAGGTCTGTGG - Intergenic
992578086 5:78140460-78140482 CTCACTAGACACCAGAACTGTGG - Intronic
993771768 5:91937156-91937178 CTTTCTCCACATCAGCAATGAGG + Intergenic
996877130 5:128252163-128252185 CTTGATCCAAACCTGGACTGAGG - Intergenic
998642879 5:144032089-144032111 TTCACTCCACCCCAGGATTGAGG + Intergenic
1001430234 5:171655092-171655114 CTTTCTCCACACCAGCCTTGTGG - Intergenic
1002373041 5:178769802-178769824 ATTACTCAACACGAGGAGTGGGG + Intergenic
1005614565 6:27560252-27560274 ATTATTCCCCAGCAGGACTGGGG - Intergenic
1006115716 6:31775210-31775232 CTTAATCTCCACAAGGACTGAGG - Intronic
1006435439 6:34023634-34023656 CTTACTCCACACCAGGACTGGGG + Intronic
1006738156 6:36289807-36289829 CTTACTCACCTCCAGGACTGGGG + Intronic
1007628656 6:43260401-43260423 TTCACTCCACAGTAGGACTGGGG + Intronic
1010082354 6:71878675-71878697 CTTACTCAAAAGCTGGACTGGGG + Intergenic
1011013208 6:82725324-82725346 CTCAATCCACACCAGCAATGTGG + Intergenic
1012862729 6:104579892-104579914 TGTCCTCCACACCAGGCCTGGGG + Intergenic
1013430735 6:110052824-110052846 CATACTGCACATCTGGACTGAGG - Intergenic
1014386445 6:120808078-120808100 TTCACTCCACTCCATGACTGAGG - Intergenic
1016997316 6:149969769-149969791 CTTTCTCCACAGCAGGAGGGTGG + Intronic
1018404387 6:163462783-163462805 ATTATTCCATACCAGGATTGTGG - Intronic
1019564173 7:1671398-1671420 CTTCCTGCACACCCGGAGTGGGG + Intergenic
1019605450 7:1907836-1907858 CTCACTCCACACCTGGACTCAGG - Intronic
1020205168 7:6108950-6108972 CTTTCTCTACACCAGGTCAGAGG + Intronic
1022471713 7:30685599-30685621 CCTACTCCACTGCAGGACAGAGG + Intronic
1036616781 8:10393958-10393980 CTTACAACACACAAGGCCTGGGG - Intronic
1038036252 8:23689300-23689322 CCTGCCCCACACCAGGACAGGGG + Intergenic
1041800325 8:61791045-61791067 CTTGCTCCACACAAGCACTCAGG + Intergenic
1043010949 8:74880786-74880808 CTCACCCCTCTCCAGGACTGAGG - Intergenic
1045008110 8:97933535-97933557 CCTATTCGACACCAGGATTGCGG - Intronic
1048841751 8:138572755-138572777 CTTCCTCCTCACCTGGACTCAGG + Intergenic
1049806721 8:144544323-144544345 CCTCCTCCACACCTGGGCTGGGG + Intronic
1057848591 9:98545669-98545691 CTTATTCCAAACCAGGGGTGTGG - Intronic
1060239508 9:121890729-121890751 CTTACTCTGCACCAGGATGGAGG - Intronic
1061520922 9:131117376-131117398 CTTTCTTCACACCATGACTGTGG - Intronic
1061956391 9:133963558-133963580 CTTTCTACACAGCAGGGCTGTGG + Intronic
1062277049 9:135736177-135736199 CCCACCCCACACCAGGGCTGGGG + Intronic
1062736157 9:138138473-138138495 CTGACTCCAAGGCAGGACTGAGG - Intergenic
1186662583 X:11684105-11684127 CTTACTCCACTCCAGTCCTTTGG - Intergenic
1186754461 X:12655854-12655876 CTAACTGCTCACCAGGACTTTGG + Intronic
1189235348 X:39482785-39482807 CCTACTCAATCCCAGGACTGAGG - Intergenic
1190084276 X:47381918-47381940 CTTATTCCAAACCAGCACTCAGG + Intronic
1192535695 X:71925340-71925362 CTTACTGCATACCAGGGCAGTGG - Intergenic
1197862763 X:130987950-130987972 CCTCCTCCTCACCAGCACTGGGG - Intergenic
1200409545 Y:2847640-2847662 CTTCCTCCACACCACAGCTGGGG - Intronic
1201463021 Y:14248814-14248836 CTTGCTCCACAACAGGATTGGGG + Intergenic