ID: 1006435859

View in Genome Browser
Species Human (GRCh38)
Location 6:34025956-34025978
Sequence CAGTGTGAGGGGAAGGCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 345}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006435850_1006435859 -10 Left 1006435850 6:34025943-34025965 CCCGGAGCACCCTCAGTGTGAGG 0: 1
1: 0
2: 1
3: 14
4: 238
Right 1006435859 6:34025956-34025978 CAGTGTGAGGGGAAGGCCAAGGG 0: 1
1: 0
2: 1
3: 26
4: 345
1006435847_1006435859 24 Left 1006435847 6:34025909-34025931 CCAGCACTGGGGACTGGATAGGG 0: 1
1: 0
2: 3
3: 11
4: 193
Right 1006435859 6:34025956-34025978 CAGTGTGAGGGGAAGGCCAAGGG 0: 1
1: 0
2: 1
3: 26
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006435859 Original CRISPR CAGTGTGAGGGGAAGGCCAA GGG Intronic
901092739 1:6653025-6653047 CACTGTGAGCCCAAGGCCAAAGG + Intronic
902234585 1:15049240-15049262 CAGTGTGTGGGGGATGCCCATGG - Intronic
902292105 1:15442298-15442320 CAGGGTGAGGGGAAGGGCCTGGG - Intronic
902691978 1:18115664-18115686 CAAGGTGATGGGAAGACCAAGGG + Intronic
902728053 1:18350343-18350365 CTGGGTCAGGGCAAGGCCAAGGG + Intronic
902732520 1:18378566-18378588 CACTGAGAGGGGAATGGCAAGGG + Intergenic
902983561 1:20142099-20142121 CTGGGAGAGGGGAAAGCCAACGG - Intronic
903216433 1:21846072-21846094 CAGTGGGACGGGAAGGCCGGGGG - Intronic
903884226 1:26531624-26531646 CTGTGAGAGGGGAAGACCAGCGG + Intronic
904613365 1:31737047-31737069 CACTGTGCAGAGAAGGCCAAGGG + Intronic
904823864 1:33262146-33262168 AGGTGTGTAGGGAAGGCCAAGGG + Intronic
906137457 1:43509496-43509518 CAGTTTAGGGGGAAGGGCAAGGG - Intergenic
906636327 1:47412812-47412834 CAGTGTCAGGGGGCGGCCCAAGG - Intergenic
906922240 1:50076946-50076968 CTGTGAGAGGGGAAAGCTAAGGG + Intronic
906969762 1:50499199-50499221 GAGTCTGAGGGGAAGGAGAATGG + Intronic
909089157 1:71204502-71204524 CAGGGTGACGGAAAGCCCAATGG + Intergenic
911049082 1:93654326-93654348 CAGTGTTATGAGAAGGCCTATGG + Intronic
911405397 1:97431849-97431871 TAGTGGGAGGGGAAGGGGAAGGG - Intronic
912627374 1:111216652-111216674 CAGTGTAAGAGGAAGGATAATGG - Intronic
912726560 1:112063926-112063948 CAGAAGGAGGGGAGGGCCAAGGG - Intergenic
913045802 1:115072677-115072699 CCGTGTGAGGGCAAGGGGAAGGG + Intronic
913464493 1:119125905-119125927 CTGTGTGATGGCAAGGCCCAGGG - Intronic
913958115 1:143321355-143321377 CAGGGTCAGGGCAGGGCCAAAGG + Intergenic
913966726 1:143383020-143383042 AAGGGTGAGAGGAAGGGCAAGGG - Intergenic
914052430 1:144146730-144146752 CAGGGTCAGGGCAGGGCCAAAGG + Intergenic
914061103 1:144208627-144208649 AAGGGTGAGAGGAAGGGCAAGGG - Intergenic
914118047 1:144757742-144757764 AAGGGTGAGAGGAAGGGCAAGGG + Intergenic
914126767 1:144819811-144819833 CAGGGTCAGGGCAGGGCCAAAGG - Intergenic
914235487 1:145806699-145806721 CAGTCATAGTGGAAGGCCAAGGG - Intronic
915170489 1:153973851-153973873 CACTGTGAGGTGAAGGCAAGAGG - Exonic
915471092 1:156126290-156126312 AAGTGGGAGGGGAAGACAAAGGG - Intronic
915566308 1:156715256-156715278 CTGAGTGAGGGGAAAGCCAATGG - Intergenic
917679920 1:177355253-177355275 CAGTGTGAGGGGATGACAAAAGG + Intergenic
918190656 1:182170913-182170935 GAGAAGGAGGGGAAGGCCAAAGG - Intergenic
919977992 1:202625451-202625473 CAGTGTGCGGGGAGGGGGAAGGG + Intronic
920182295 1:204139592-204139614 CAGGGTATGGGGAAGGCCAGAGG - Intronic
921593547 1:217030442-217030464 CAGTGTGGTGGGAAGGCCACTGG + Intronic
922851943 1:228739953-228739975 CAGTGTGGAGGGAAGACAAATGG + Intronic
923226098 1:231940165-231940187 CAGAGAGAGGGGAAGGACAGAGG - Intronic
923235821 1:232031670-232031692 CAGTGGGTGGGGGAGGGCAAGGG + Intronic
1062822403 10:544532-544554 TAGTGGGAGGGGAAGGAAAATGG - Intronic
1062997304 10:1878896-1878918 GAGTGTGAGGGGAAAGACAGGGG + Intergenic
1063369985 10:5514902-5514924 CAGTGGGAAAGGAAGGCCCAGGG + Intergenic
1063403944 10:5774886-5774908 CAGGGGAAGGGGAAGGGCAAGGG + Intronic
1063447712 10:6130116-6130138 CACTGTGATGGGAAGGGCACAGG - Intergenic
1064295281 10:14073655-14073677 CGGAGTGAGGGGAAGTCCAGGGG + Intronic
1064513245 10:16118180-16118202 CAGTGTGAGGGAAAGGTGAGAGG - Intergenic
1064653889 10:17537350-17537372 CAGAGTGAGGTGGAGACCAAGGG - Intergenic
1066759492 10:38739006-38739028 CAGTGCCAGGGCAAGGACAAGGG - Intergenic
1066962126 10:42233755-42233777 CAGTGCCAGGGCAAGGACAAGGG + Intergenic
1070831293 10:79419566-79419588 ATGTGAGAGGGGCAGGCCAAGGG + Intronic
1071581543 10:86775972-86775994 CAGTGGGAGAGGACTGCCAAGGG - Intronic
1073592149 10:104767678-104767700 AAGTGGGAGGGGAAGGGGAAGGG - Intronic
1074276845 10:112011585-112011607 CAGTGTCAGGGGAGGGTGAATGG - Intergenic
1074687864 10:115976489-115976511 CACTGTGAGGGGCAGCCCAAGGG - Intergenic
1075343639 10:121666597-121666619 GAGTCTAAGTGGAAGGCCAAGGG - Intergenic
1076258396 10:129046439-129046461 TATTGTGAGGGTCAGGCCAAGGG + Intergenic
1077458008 11:2692539-2692561 AAGTGGCAGGGGCAGGCCAAGGG - Intronic
1079129413 11:17738611-17738633 CAGTGGGAGGAGAGGGCCAGGGG - Intronic
1079135716 11:17775074-17775096 GAGAGTGAGGGGGAGGCCAGGGG + Intronic
1079289920 11:19178785-19178807 AAGTGTGAGAGGAAGGAGAAGGG + Intergenic
1079360314 11:19765451-19765473 CAGAGGGAGGGGAAGGGGAAGGG - Intronic
1079381983 11:19946219-19946241 AAGTGTGAATGGAAGCCCAAAGG - Intronic
1080440711 11:32291871-32291893 GAGTGAGAGGGGATTGCCAAGGG + Intergenic
1083629935 11:64090211-64090233 CAGGGTGTGGGAAAGGCCAACGG + Intronic
1087315227 11:96594531-96594553 CAGTTTGAGAGAAAGGCAAATGG - Intergenic
1088423439 11:109674211-109674233 CTGAGTGAGGGGATGGACAATGG - Intergenic
1089065441 11:115659122-115659144 CAGGGGGAGGGGAAGGACACAGG + Intergenic
1091095731 11:132820565-132820587 CTGAATGAGGGTAAGGCCAAGGG - Intronic
1091202788 11:133794983-133795005 CAGTGGGAGAGGGAGTCCAATGG + Intergenic
1091908051 12:4205347-4205369 CAGTGGGAGAGCAAGGACAAAGG + Intergenic
1093761856 12:22920020-22920042 AAGTGTGGGCTGAAGGCCAATGG + Intergenic
1096660128 12:53119013-53119035 CAGTGGGAGGGTGATGCCAAGGG + Intronic
1096869693 12:54585552-54585574 CAGTGGGGAGGGAAGGCAAATGG + Intronic
1098138544 12:67428309-67428331 CAGTGGGAGAGAAAAGCCAAGGG + Intergenic
1098839369 12:75460094-75460116 AAGGGTGAGGGGAAGGAAAATGG + Intergenic
1098919667 12:76292175-76292197 CAGAGTGAGGGCAAGGACAGCGG - Intergenic
1100227506 12:92574008-92574030 CAATTTGAGGGGGAGGCTAAGGG - Intergenic
1100436871 12:94579173-94579195 CAGTGAGAGGGGCAGGGCACAGG - Intronic
1101129890 12:101678217-101678239 CAGTGTGAGAGGAAATCCTAAGG + Exonic
1102171035 12:110842669-110842691 CAGTGAGAGGGGAAGTCCGCTGG - Intergenic
1102351599 12:112196537-112196559 AAGTCTGAGGTGAAAGCCAAGGG - Intronic
1102357404 12:112250351-112250373 CAGTGGCAGGTGGAGGCCAATGG - Exonic
1103050940 12:117778999-117779021 CACAGGGAGGGGAAAGCCAAAGG - Intronic
1104676354 12:130714719-130714741 CGGTGTGAGGGGAAGGCCGGCGG - Intronic
1105726242 13:23164985-23165007 CAGTGGGAGGGGAGGGCCACAGG - Intergenic
1105782932 13:23720261-23720283 CAGGGTGATGGGAAGAGCAATGG - Intergenic
1106477149 13:30108553-30108575 AAGTGAGACGGGAAGGTCAAGGG + Intergenic
1108272597 13:48776537-48776559 CATTGTGAGGGGAGTGACAAGGG + Intergenic
1110545953 13:76755549-76755571 CAGTGAGGGTGGATGGCCAATGG - Intergenic
1113222788 13:108124345-108124367 CAGTGTGAGGGGAAGGCTGGTGG - Intergenic
1113709344 13:112453534-112453556 CAGTGAGAGGGTGAGGCCACCGG + Intergenic
1114216326 14:20660282-20660304 CAGAGGGAGAGGAAGGCCACAGG - Intergenic
1114771262 14:25430471-25430493 CAGAGTGAGGGCAAGGACAGGGG + Intergenic
1117255996 14:53978350-53978372 CAGTGTTAGGGGAATCCCATTGG + Intergenic
1117383029 14:55184520-55184542 CAGTGTGAGGGGATGACACAGGG - Intronic
1117563095 14:56965102-56965124 CAGTGTGACAGGAAAGCAAAGGG + Intergenic
1118894766 14:69936536-69936558 CAGTGGGAGGGGAAGGAGGAAGG - Intronic
1119771336 14:77221993-77222015 CAGGGTGAGGGGAAGGATATGGG - Intronic
1120571955 14:86129661-86129683 CTGTGAGGAGGGAAGGCCAAGGG + Intergenic
1121680980 14:95792526-95792548 CAGTGTCAGGGCAGAGCCAATGG + Intergenic
1123033270 14:105461117-105461139 CAGTGTGACAGGAAGGACTATGG - Intronic
1123126366 14:105948961-105948983 CACTGTGGGGAGAAGGCCGATGG + Intergenic
1123406874 15:20024994-20025016 CACTGTGGGGAGAAGGCCGATGG + Intergenic
1123422152 15:20142907-20142929 CAGTGCCAGGGCAAGGGCAAGGG + Intergenic
1123442921 15:20303710-20303732 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
1123516205 15:21031650-21031672 CACTGTGGGGAGAAGGCCGATGG + Intergenic
1123531380 15:21149447-21149469 CAGTGCCAGGGCAAGGGCAAGGG + Intergenic
1124155901 15:27225238-27225260 CACTGTCATGGGAAGGACAAGGG - Intronic
1124493600 15:30173375-30173397 CAGTGTGCGGGGAGGGGGAAGGG + Intergenic
1124749968 15:32365274-32365296 CAGTGTGCGGGGAGGGGGAAGGG - Intergenic
1126642489 15:50841970-50841992 GAGGGGGAGGGGAAGGGCAAGGG - Intergenic
1127272029 15:57410116-57410138 CAGTGTGAGGGTCAGGCCCGAGG + Intronic
1128108793 15:65063305-65063327 CAGTGTCTGGGAAAGGACAAGGG - Intronic
1129181598 15:73881523-73881545 CAGTTCCAGGGCAAGGCCAAGGG - Intronic
1130896413 15:88173662-88173684 CAGATGGAGGGGAAGGCCCATGG - Intronic
1130917207 15:88314498-88314520 CAGGGTTAGCAGAAGGCCAATGG + Intergenic
1131370271 15:91875315-91875337 CAGTGGGAGGGGAGGGTCAGAGG - Intronic
1131622362 15:94081431-94081453 CAGTGTCAGGGAAAGGCACATGG + Intergenic
1132012409 15:98287694-98287716 CAGGGTGAGGGGCTGCCCAATGG + Intergenic
1133116418 16:3580270-3580292 CAGTGTGAGCCCAAGGCCAGGGG - Intergenic
1136281378 16:29213427-29213449 CAGTGGGAGAGGAAGCCAAAGGG - Intergenic
1136718254 16:32301755-32301777 CAGGGTCAGGGCAGGGCCAAAGG + Intergenic
1136718322 16:32301972-32301994 CAGTGCCAGGGCAAGGGCAAGGG + Intergenic
1136723291 16:32340157-32340179 CAGTGCCAGGGCAAGGACAAGGG + Intergenic
1136773638 16:32860174-32860196 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
1136836628 16:33508025-33508047 CAGGGTCAGGGCAGGGCCAAAGG + Intergenic
1136836696 16:33508242-33508264 CAGTGCCAGGGCAAGGGCAAGGG + Intergenic
1136862684 16:33712768-33712790 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
1136896973 16:34001345-34001367 CAGTGCCAGGGCAAGGGCAAGGG + Intergenic
1137597486 16:49734469-49734491 CAGGCCGAGGAGAAGGCCAATGG + Intronic
1140111895 16:72011914-72011936 CAGTGTCAGCGGAAGGCTAAGGG + Intronic
1140112059 16:72012892-72012914 CAGTGTCAGCGGAAGGCTAAGGG + Intronic
1142085748 16:88179355-88179377 CAGTGGGAGAGGAAGCCAAAGGG - Intergenic
1203003141 16_KI270728v1_random:177608-177630 CAGTGCCAGGGCAAGGACAAGGG - Intergenic
1203008106 16_KI270728v1_random:215793-215815 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
1203008174 16_KI270728v1_random:216010-216032 CAGGGTCAGGGCAGGGCCAAAGG - Intergenic
1203076057 16_KI270728v1_random:1122285-1122307 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
1203124160 16_KI270728v1_random:1560910-1560932 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
1203134746 16_KI270728v1_random:1714014-1714036 CAGTGCCAGGGCAAGGACAAGGG - Intergenic
1203146882 16_KI270728v1_random:1808543-1808565 CAGTGCCAGGGCAAGGGCAAGGG + Intergenic
1144732519 17:17536890-17536912 CAGTCTGAGTGGAAGGCAAGAGG + Intronic
1144732608 17:17537305-17537327 CAGGGCAAGGGGAAGGCAAAGGG - Intronic
1145065821 17:19760442-19760464 CAGTGTGAGCTGAAGGCGCATGG - Intergenic
1145254405 17:21314761-21314783 CAGTGCCAGGGGAAGGCCTTGGG - Exonic
1146699231 17:34940167-34940189 CAGTGGGAGGGGAGGGGCACTGG - Intronic
1147566273 17:41538141-41538163 CTGAGGGAGGGGAAGGACAAGGG + Intergenic
1148447493 17:47746386-47746408 GGGTGTGAGGGCAAGGCCAAGGG + Intergenic
1148700170 17:49582324-49582346 CAGTGGATGGGGAAGGTCAACGG - Intronic
1149498554 17:57134495-57134517 CAGTGTTAGGGGAAAGGCAGGGG - Intergenic
1149553502 17:57557121-57557143 CAGACTGAGGGGTAAGCCAAAGG + Intronic
1152327758 17:79651458-79651480 CAGTGGGAGGGGACGGCCCGGGG - Intergenic
1153405395 18:4733054-4733076 CAGTCTTAGGGGAAGGAGAAGGG - Intergenic
1153946647 18:10023823-10023845 CTGTGAGAGGGGAGGGCCACTGG + Intergenic
1154415159 18:14172285-14172307 CAGTGCCAGGGAAAGGGCAAGGG + Intergenic
1155611136 18:27669155-27669177 CAGTGGGAGGGGAGGGCAAGTGG - Intergenic
1156219504 18:35037528-35037550 CAGTTGGAGGTGAAGGGCAATGG + Intronic
1157806898 18:50665091-50665113 CAGTGTGATGTGAAAGCCATGGG + Intronic
1158835738 18:61329970-61329992 CAGAGTCAGGGGAAGACCACTGG - Intergenic
1159084218 18:63769969-63769991 CAGTGTGAGTGGAAGGGGAAGGG + Intronic
1159478322 18:68953762-68953784 TAGTCTGAGGAGAAGGCAAATGG + Intronic
1160891395 19:1380570-1380592 CAGTGAGAGGGGAAGGACCCAGG - Intergenic
1162409882 19:10499347-10499369 CAGTGTCAGGAGAAGGACCAGGG - Intronic
1163062735 19:14772157-14772179 CAGCGTGGTGTGAAGGCCAAGGG - Intronic
1165758464 19:38307541-38307563 CTGTGTGAGGACAAGGCCCAAGG + Intronic
1165792018 19:38498337-38498359 CAGATTGAGGGGAAGGCAGAAGG + Intronic
1166367716 19:42285742-42285764 CAGTGTGAGGGGAAGCCCACTGG + Intronic
1166435253 19:42762137-42762159 GAGTGTCTGGGGAAGGCCTAGGG + Intronic
1166452521 19:42914340-42914362 GAGTGTCTGGGGAAGGCCTAGGG + Intronic
1166464799 19:43022906-43022928 GAGTGTCTGGGGAAGGCCTAGGG + Intronic
1166482078 19:43183008-43183030 GAGTGTCTGGGGAAGGCCTAGGG + Intronic
1166484559 19:43202123-43202145 GAGTGTCTGGGGAAGGCCTAGGG + Intronic
1168317020 19:55488958-55488980 CAGTGTGAGGGGCAGGCCGGGGG - Intronic
1202691828 1_KI270712v1_random:99154-99176 CAGGGTCAGGGCAGGGCCAAAGG + Intergenic
1202700510 1_KI270712v1_random:160515-160537 AAGGGTGAGAGGAAGGGCAAGGG - Intergenic
925716095 2:6785710-6785732 AAGTGGGAAGGGAAGGCCCAAGG + Intergenic
925818015 2:7772171-7772193 CAGTGTGGGTGGCAGGCAAAAGG - Intergenic
927111173 2:19864726-19864748 CTGTGTGAGAGGAAGGGCAGAGG - Intergenic
929580591 2:43079623-43079645 CAGTGTGGGGCCAAGGACAAAGG - Intergenic
930267677 2:49219057-49219079 CAGGGAGAAGGGAAGGCCAGAGG + Intergenic
931769639 2:65486460-65486482 CAGGGTGTGGGGAAAGCCAGGGG + Intergenic
932493497 2:72135465-72135487 CAGAGTGAGGGGCTGGCCAGGGG - Intronic
932612495 2:73210215-73210237 CAGTGAGAGGAGAAAGTCAAGGG - Intronic
933367033 2:81366009-81366031 CAGAGTGAGGCTAAGGCCAATGG - Intergenic
933954562 2:87354802-87354824 CAGGGTCAGGGCAGGGCCAAAGG - Intergenic
934143336 2:89069594-89069616 CAGTGTGAAGGAAAGGACTATGG - Intergenic
934165293 2:89288776-89288798 CAGTGAAGGGGAAAGGCCAAGGG - Intergenic
934171438 2:89543988-89544010 AAGGGTGAGAGGAAGGGCAAGGG - Intergenic
934201981 2:89893686-89893708 CAGTGAAGGGGAAAGGCCAAGGG + Intergenic
934225905 2:90130961-90130983 CAGTGTGAAGGAAAGGACTATGG + Intergenic
934238698 2:90250822-90250844 CAGTGTCAGGGCAAGAGCAAGGG - Intergenic
934274438 2:91565688-91565710 CAGGGTCAGGGCAGGGCCAAAGG + Intergenic
934281747 2:91618306-91618328 AAGGGTGAGAGGAAGGGCAAGGG - Intergenic
934322811 2:91983357-91983379 CAGTGCCAGGGCAAGGACAAGGG - Intergenic
934461121 2:94214153-94214175 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
934478037 2:94605824-94605846 CAGTTTGAGGGGATGGGCAGAGG + Intergenic
934666424 2:96174480-96174502 CAGTGGGAAGAGGAGGCCAAGGG - Intergenic
934888405 2:98045124-98045146 CAGAGTGAGTGCAAGGACAAGGG + Intergenic
935560505 2:104554205-104554227 AAATGGGAGGGGAAGGACAAAGG + Intergenic
935842581 2:107129338-107129360 CAGTTGTAGGGGAAGGGCAAGGG + Intergenic
938031150 2:127994795-127994817 CAGTTTGAGGGGAAAGCAAGAGG - Intronic
942419037 2:175788794-175788816 CAGGGTGTGGAGAAGGCCAGAGG + Intergenic
942490560 2:176485571-176485593 CAGTGAGAGGGTGAGGCAAATGG + Intergenic
945203711 2:207310187-207310209 CACTGTAAGGGGCAGCCCAAGGG + Intergenic
946114230 2:217447445-217447467 AAGTGTGAGGGGAAGGACTCTGG + Intronic
946428575 2:219613019-219613041 CAGTGGGAGGGTCAGGCCGAGGG + Intronic
947414318 2:229878204-229878226 CACTCTGAGGCCAAGGCCAATGG + Intronic
948797418 2:240412080-240412102 CTGTGTGCGGGGAAGGAGAACGG - Intergenic
1168995635 20:2130858-2130880 CGGTGTGACGGGATGGCCAAAGG - Intronic
1169894649 20:10489762-10489784 CAGTGAGAGGGAAAGGGAAATGG + Intronic
1171175543 20:23049014-23049036 CAGTGCGAAGTGAAGGCCGATGG - Exonic
1171211683 20:23321722-23321744 CAGAGTGAGCGGGAAGCCAAAGG + Intergenic
1172460957 20:35118334-35118356 CACTGTGGGAGGAATGCCAAGGG + Intronic
1175692461 20:61075470-61075492 CAGTGTGAGGAGTGGTCCAAAGG - Intergenic
1175699305 20:61125468-61125490 CAGGGGGAGGGGAAGGAGAAGGG + Intergenic
1176040723 20:63064489-63064511 CAATCCGAGGGCAAGGCCAAGGG + Intergenic
1176304476 21:5115965-5115987 CAGTGGGTGGGGAGGGCCGAGGG + Intergenic
1176418423 21:6494353-6494375 CAGTCTAATGGGAAAGCCAAGGG + Intergenic
1176866423 21:14057177-14057199 CAGTGCCAGGGAAAGGGCAAGGG + Intergenic
1178011807 21:28295799-28295821 CAGGGTGAGAGGAAGTCCCAGGG + Intergenic
1179693916 21:43102675-43102697 CAGTCTAATGGGAAAGCCAAGGG + Intronic
1179839936 21:44065518-44065540 CAGTGAGAGGAGGTGGCCAAAGG + Intronic
1179852580 21:44146065-44146087 CAGTGGGTGGGGAGGGCCGAGGG - Intergenic
1180549571 22:16529255-16529277 CAGTGCCAGGGCAAGGACAAGGG - Intergenic
1181355121 22:22292573-22292595 CAGTGCCAGGGCAAGGGCAAGGG + Intergenic
1181849934 22:25742799-25742821 GAGTGTTGGGGGAAGGGCAATGG + Intronic
1183349251 22:37325429-37325451 CAGTGTGCCGGGCAGGCCAGGGG - Intergenic
1183378146 22:37476982-37477004 CTGAGAGAGAGGAAGGCCAAGGG + Intronic
1183404723 22:37624856-37624878 GTGTGTGAGGGGAAGGGAAAGGG - Intronic
1183715377 22:39530172-39530194 CAGTGAGAGATGAAGGACAAAGG + Intronic
1183927136 22:41214301-41214323 AAGTGTGGGGTGAAGACCAAGGG - Intronic
1184533355 22:45070762-45070784 CAGGGTGAGGGGTAGGGCAGGGG - Intergenic
1184581089 22:45418272-45418294 CAGTCTGCGGGGAAGGTGAATGG + Intronic
1184588047 22:45460926-45460948 CAGTGTGTGATGAATGCCAAGGG - Intergenic
950887187 3:16372688-16372710 CAGGAAAAGGGGAAGGCCAAAGG + Intronic
951889268 3:27553302-27553324 CAGAGTGAGGGTGAGGACAAGGG + Intergenic
953884220 3:46706467-46706489 CATTCTGAGGGGAGGGCTAAGGG - Intronic
958069971 3:88597658-88597680 CATTTTGAGGAGAAAGCCAAGGG + Intergenic
960084694 3:113578053-113578075 CAGTGGCAGGAGAGGGCCAAAGG + Intronic
960855534 3:122098533-122098555 CAGTGTGAGGGGAAGGGATCTGG + Intronic
960975474 3:123169742-123169764 CAGTGAGAGTGGAAGACAAAGGG + Intronic
961389785 3:126545635-126545657 CAGGGTGAAGGCAAGGCCCAGGG + Intronic
961625092 3:128255986-128256008 GAATGTGAGGGGATGGCCTAGGG + Intronic
962270054 3:133971029-133971051 CAGTGTGAGGCAAATGCCACTGG + Intronic
963223587 3:142837911-142837933 CAATGTGAGGGGGAGGCATAAGG + Intronic
964939798 3:162143901-162143923 AAGTGGGAGAGGAAGGCAAATGG - Intergenic
967612171 3:191520369-191520391 CAGTGAGAGGTGAGGGCAAATGG + Intergenic
968039245 3:195574509-195574531 CACTGTGTGGGGAAGGTCGAGGG + Intronic
968599496 4:1502402-1502424 CAGTGGGAGGGGAGGGGCATGGG - Intergenic
968734555 4:2288593-2288615 CAGTGTGAGCTGAAGGCCCTTGG + Intronic
969116116 4:4871754-4871776 CAGAGGGAGGGGAAAGCCAGCGG - Intergenic
969422530 4:7105596-7105618 CAGAGTCAGGGGAAGGCTCATGG - Intergenic
969471168 4:7390058-7390080 CACTGTGAGGGGGAGGCCCACGG + Intronic
970210326 4:13703280-13703302 CAGTGTGTGGGGAAGGCTGGTGG - Intergenic
971443395 4:26715365-26715387 CACTGTGACGGCAGGGCCAACGG - Intronic
972299434 4:37771175-37771197 GGGTGTGAGGGGAAGGCCTGTGG - Intergenic
976681137 4:87757427-87757449 GAGTGTGAGGAGAAGGAAAAGGG + Intergenic
976983479 4:91262123-91262145 CAGTGTGTGGTGAAGAACAAGGG + Intronic
978201009 4:106023671-106023693 GAGTGAGACAGGAAGGCCAAAGG - Intergenic
980399549 4:132262943-132262965 CAGTTATAGTGGAAGGCCAAGGG - Intergenic
981474474 4:145175028-145175050 TATTGTGGAGGGAAGGCCAAGGG - Intronic
982889455 4:160829261-160829283 CATTCAGAGCGGAAGGCCAAGGG + Intergenic
984172878 4:176381856-176381878 CAGTGTGAGGGGCAGGGCAGTGG - Intergenic
984722585 4:182989564-182989586 AAATGAGAGGGGTAGGCCAAAGG + Intergenic
984770352 4:183431902-183431924 CGGGGTGAGGGGGAGGCCAGGGG + Intergenic
986315635 5:6584585-6584607 CTTGGTGATGGGAAGGCCAAGGG + Intergenic
986432234 5:7692688-7692710 AAGTGGGAGGACAAGGCCAAGGG - Intronic
992162541 5:74016866-74016888 CAGTGTAAGGGGGAGGTGAATGG + Intergenic
992758430 5:79930755-79930777 CCTTGTGAGGGGCAGGCCAAGGG - Intergenic
993004309 5:82414187-82414209 CAGAGTGAGGGCATGGGCAATGG + Intergenic
993399521 5:87431638-87431660 GAGTTTGAGGGGAAGGGGAATGG + Intergenic
993885276 5:93408733-93408755 CTGTATGAGGTAAAGGCCAATGG + Intergenic
995280293 5:110327455-110327477 CAGTGTGAGGTGATAGCCTATGG + Intronic
998197247 5:140084873-140084895 CCATGTGAGGGGAATGCAAATGG - Intergenic
1000059216 5:157638301-157638323 CAGTGTGGCTGGATGGCCAAGGG + Exonic
1000309083 5:160024069-160024091 AAGTGTGGGGGGATGGGCAATGG + Intronic
1000869043 5:166552637-166552659 CAGTGTTAGAGGTAGGGCAAGGG - Intergenic
1001711975 5:173786373-173786395 CAGTGGCAGCAGAAGGCCAAGGG - Intergenic
1001712400 5:173789270-173789292 CAGGGTGAGGAGGAAGCCAATGG - Intergenic
1002326051 5:178407114-178407136 CAGTGTCAGTGGAAGCCCCATGG + Intronic
1002409554 5:179062725-179062747 CACTGGGAGGGGAAGGCCCCAGG - Intronic
1002567449 5:180119804-180119826 CAGTGAGAGGAGAAAGCCCAGGG - Intronic
1003040778 6:2685532-2685554 AAGTGTGAGGAGACGGCCACAGG - Exonic
1003444285 6:6170555-6170577 CGGTGTCTGGGGAAAGCCAAGGG + Intronic
1003445912 6:6184306-6184328 CGGTGTGCCGTGAAGGCCAAGGG - Intronic
1003487536 6:6592519-6592541 CAGGGTGAGGGGAAGCATAAGGG + Intronic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006435859 6:34025956-34025978 CAGTGTGAGGGGAAGGCCAAGGG + Intronic
1006510504 6:34518738-34518760 CAGCGTGAGGGACAGGGCAAAGG - Intronic
1009296336 6:61953827-61953849 AAGAGTGAGGGGAAGGGCATGGG + Intronic
1010453779 6:76031290-76031312 CATGATGATGGGAAGGCCAAGGG + Intronic
1010699673 6:79028156-79028178 GAGTGTGAGGTGAAGGCATAAGG + Intronic
1010795549 6:80113285-80113307 CAGTGTTACCTGAAGGCCAAGGG - Intronic
1011399988 6:86950393-86950415 CAGTGTGGTGGGAAGGTCCATGG + Intronic
1013191567 6:107808149-107808171 CAGAGTCAGAGGAAAGCCAAAGG + Intronic
1015131717 6:129818729-129818751 CATTTTGGGGGGAAGGACAAGGG + Intergenic
1015825088 6:137302784-137302806 CAGGGTGCGTGGAAGGGCAAAGG + Intergenic
1016802780 6:148183428-148183450 CAGTGTGAGGAGATGGCTACGGG - Intergenic
1018160894 6:161041374-161041396 CAGGGTTAGGGGAAGGACCAGGG - Intronic
1019148515 6:169988899-169988921 CCGTGGGAGGGGGAGGCCACTGG - Intergenic
1020146354 7:5646918-5646940 CAGTGTGAGGTGAAAGCCTAGGG + Intronic
1021524626 7:21573729-21573751 CAATGGGAGGGGAAGGGCAGAGG - Intronic
1021962530 7:25887108-25887130 CAGTGTGAAGGCCAGGCCCAGGG + Intergenic
1022162998 7:27730859-27730881 CAGTGTGAAGGGATGGTAAAGGG + Intergenic
1023531557 7:41161869-41161891 CAGTGTTATGGGAAGACAAATGG + Intergenic
1024380839 7:48694723-48694745 CAGTGTGAGGGAATGGGGAAGGG + Intergenic
1027342431 7:77223417-77223439 GAATGTGAGGGGGAGGTCAAAGG - Intronic
1028526841 7:91795964-91795986 CACTGTGAGAGAAAAGCCAAAGG + Intronic
1028590141 7:92484772-92484794 CAGAGTGAGGGCAAGGACAGGGG + Intergenic
1028867062 7:95725646-95725668 CAGTGTGAGGGGCAGGCCTGAGG - Intergenic
1029255781 7:99268558-99268580 CAGTTCCAGGGGAAGGCCCAGGG + Intergenic
1031985415 7:128161527-128161549 GAGTGTGAGGTGAAGCACAAAGG - Intergenic
1032794938 7:135269626-135269648 CAGTGGGAAGGCAGGGCCAAGGG + Intergenic
1034621436 7:152460207-152460229 CAGGGTGAGGGCAAGGCCAGTGG + Intergenic
1038752143 8:30305518-30305540 GAGTGTGAGAGGAAGGTGAATGG - Intergenic
1040389234 8:46935431-46935453 CTGTGTGGTGGGAAGGGCAAGGG - Intergenic
1040420848 8:47239202-47239224 CAGTGTCAGGCTAAGGCCAAAGG + Intergenic
1041717785 8:60947911-60947933 GAGGGTGAGGGGAAGGACATGGG - Intergenic
1042227523 8:66525546-66525568 CAGTGGGAGGGGCAGGGCACAGG + Intergenic
1042564974 8:70101995-70102017 CAGCGTGAGGGGATGGGTAATGG - Intergenic
1044175795 8:89120604-89120626 CAGTGTGAGGGGAGGCCTGAAGG - Intergenic
1044933199 8:97269779-97269801 AATTGTGAGGGGAAAGCCAAGGG + Intergenic
1045809947 8:106209767-106209789 CGCTGTGATAGGAAGGCCAAAGG + Intergenic
1048317009 8:133369992-133370014 CAGTGTGAGGGGCAGGCAGAGGG - Intergenic
1048785971 8:138050809-138050831 CAGTGAGATGGGAAAGACAAGGG - Intergenic
1048878422 8:138854548-138854570 CAGTGTGCTGAGCAGGCCAAAGG - Intronic
1049319217 8:141987100-141987122 CAGTGTGCTGGGAAGTGCAAGGG - Intergenic
1050928458 9:11296347-11296369 CATTGTCAGGGGCAGGGCAATGG + Intergenic
1051504493 9:17812395-17812417 CAGTGTGGGGGCCAGGCCAGAGG + Intergenic
1052851911 9:33383736-33383758 CAGTTTGAGGGGATGGGCAGAGG - Intergenic
1053114684 9:35490373-35490395 AAGGGTCAGGAGAAGGCCAAGGG - Intronic
1053680019 9:40480284-40480306 CAGTTTGAGGGGATGGGCAGAGG - Intergenic
1053691605 9:40589813-40589835 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
1054273197 9:63047672-63047694 CAGTGCCAGGGCAAGGGCAAGGG + Intergenic
1054283693 9:63144651-63144673 CAGTTTGAGGGGATGGGCAGAGG + Intergenic
1054293100 9:63315794-63315816 CAGTTTGAGGGGATGGGCAGAGG - Intergenic
1054302861 9:63390779-63390801 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
1054391126 9:64620287-64620309 CAGTTTGAGGGGATGGGCAGAGG - Intergenic
1054401642 9:64717295-64717317 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
1054435245 9:65201604-65201626 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
1054456662 9:65434691-65434713 CAGTGGGAGGGGCAGTCCCATGG + Intergenic
1054495145 9:65820077-65820099 CAGTGCCAGGGCAAGGGCAAGGG + Intergenic
1054504602 9:65896039-65896061 CAGTTTGAGGGGATGGGCAGAGG + Intergenic
1055413446 9:76056394-76056416 CCGTGTGAGGAGAGGGCAAAAGG + Intronic
1055987232 9:82063811-82063833 CAGTGAGAGGGGAGGGGCAGTGG + Intergenic
1058709630 9:107668000-107668022 CAGTGTGAGGCGGAGGCCGCGGG - Intergenic
1059326348 9:113506186-113506208 CAGGGAGAAGGGAAGGCAAAGGG + Intronic
1060069564 9:120534285-120534307 CAGTGCGAGTGGAAGTCCAGAGG - Intronic
1060182762 9:121545670-121545692 CAGTGCGAGGGGAGGGCCGCTGG + Intergenic
1060779520 9:126401128-126401150 CAGTGTTAGGGAAAGGTCACAGG - Intronic
1060788403 9:126468576-126468598 GAGTGGCTGGGGAAGGCCAAGGG - Intronic
1060960147 9:127675043-127675065 CAATGTGAGGGGAAGCAGAATGG + Intronic
1061281681 9:129601333-129601355 GAGTGTGAGGGGAAGCACAGAGG + Intergenic
1061343498 9:130002880-130002902 CAGTGTGAGGTCAAGGTCAAGGG - Intronic
1061934679 9:133850746-133850768 CAGTGAGATGGGAAGACAAAGGG - Intronic
1062327197 9:136017993-136018015 CAGTGTGATGGGAAGTCCCCCGG + Intronic
1062469804 9:136697277-136697299 CAGGCTCAGGGGGAGGCCAAGGG + Intergenic
1062623163 9:137431628-137431650 CAGTGGGAGGGGAGGGGCAATGG - Intronic
1188575602 X:31646206-31646228 CAGTGGGAAAGGAAAGCCAAAGG - Intronic
1192054600 X:67760357-67760379 CAGGGTGAGTGGAAGCCCACTGG - Intergenic
1192190057 X:68985565-68985587 CAGTGGGAGGAGAAGGACAGGGG + Intergenic
1193697178 X:84723642-84723664 CACTGTGAATGGAAGGCCACAGG - Intergenic
1193769468 X:85571902-85571924 CACTGTGCTGGGGAGGCCAAGGG - Intergenic
1193908760 X:87277024-87277046 CAGGGTGGGGAGAAGGCGAAGGG - Intergenic
1194988495 X:100518326-100518348 GAGTTAGAGGGGAAGGGCAAGGG + Intergenic
1195979070 X:110558822-110558844 CAGTGTGGGGGGGAGGGGAAGGG + Intergenic
1196569519 X:117249088-117249110 GAGAGAGAGGGGAAGGGCAAGGG - Intergenic
1199659698 X:150036657-150036679 CAGTGTGAAGGAAGTGCCAAGGG + Intergenic
1200283022 X:154794630-154794652 CACTGTGTGGGGAAGGAGAAGGG + Intronic
1200342999 X:155419063-155419085 CAGAGTGAGGGCAGGGCCAGAGG - Intergenic
1200834979 Y:7724425-7724447 CAGAAAAAGGGGAAGGCCAAAGG + Intergenic
1201925543 Y:19283285-19283307 AATTGAGAGGGGAAGGGCAATGG - Intergenic
1202583316 Y:26403382-26403404 CAGTGCCAGGGCAAGGACAAGGG + Intergenic