ID: 1006436497

View in Genome Browser
Species Human (GRCh38)
Location 6:34028405-34028427
Sequence CGGGAGTCAGGGCCCTCAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 160}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006436497_1006436501 -6 Left 1006436497 6:34028405-34028427 CCGACTGAGGGCCCTGACTCCCG 0: 1
1: 0
2: 1
3: 16
4: 160
Right 1006436501 6:34028422-34028444 CTCCCGCCAGTTCCCACCCAGGG 0: 1
1: 0
2: 5
3: 36
4: 261
1006436497_1006436500 -7 Left 1006436497 6:34028405-34028427 CCGACTGAGGGCCCTGACTCCCG 0: 1
1: 0
2: 1
3: 16
4: 160
Right 1006436500 6:34028421-34028443 ACTCCCGCCAGTTCCCACCCAGG 0: 1
1: 0
2: 2
3: 18
4: 214
1006436497_1006436513 22 Left 1006436497 6:34028405-34028427 CCGACTGAGGGCCCTGACTCCCG 0: 1
1: 0
2: 1
3: 16
4: 160
Right 1006436513 6:34028450-34028472 CCCGGCATCCCGCTGCCTTCAGG 0: 1
1: 0
2: 2
3: 9
4: 169
1006436497_1006436515 29 Left 1006436497 6:34028405-34028427 CCGACTGAGGGCCCTGACTCCCG 0: 1
1: 0
2: 1
3: 16
4: 160
Right 1006436515 6:34028457-34028479 TCCCGCTGCCTTCAGGCAGAAGG 0: 1
1: 0
2: 1
3: 20
4: 166
1006436497_1006436505 4 Left 1006436497 6:34028405-34028427 CCGACTGAGGGCCCTGACTCCCG 0: 1
1: 0
2: 1
3: 16
4: 160
Right 1006436505 6:34028432-34028454 TTCCCACCCAGGGACCCACCCGG 0: 1
1: 1
2: 3
3: 26
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006436497 Original CRISPR CGGGAGTCAGGGCCCTCAGT CGG (reversed) Intronic
901421551 1:9154551-9154573 CCTGAGTCAGGACCCTCAGATGG + Intergenic
907307827 1:53523351-53523373 TGGGAGCAAGGGGCCTCAGTGGG - Intronic
910327090 1:86022235-86022257 GGAAAGTCAGGGCCTTCAGTAGG - Exonic
913581854 1:120234165-120234187 CAGGAGTCAGAGCGCTCATTTGG - Intergenic
913626321 1:120664223-120664245 CAGGAGTCAGAGCGCTCATTTGG + Intergenic
914563785 1:148845612-148845634 CAGGAGTCAGAGCGCTCATTTGG - Intronic
914609042 1:149284614-149284636 CAGGAGTCAGAGCGCTCATTTGG + Intergenic
914947627 1:152080525-152080547 CAGGAGGCAGGACCCTCTGTGGG + Intergenic
916127136 1:161581549-161581571 GGTGAGTCAGGGCCCCCAGGAGG + Intronic
916137056 1:161663353-161663375 GGTGAGTCAGGGCCCCCAGGAGG + Exonic
916942401 1:169689538-169689560 AGGGAGTCAGAGGCATCAGTGGG - Intronic
917191437 1:172422996-172423018 TGGGAGTCAGGGCCTGGAGTTGG - Intronic
920062571 1:203237806-203237828 CTGGAGTCAGGGCACTCTCTGGG + Intronic
922532740 1:226356890-226356912 CAGGGGTCAGGGCCCACAGAAGG - Intergenic
1063980426 10:11447626-11447648 GGGAAGTCAGGGCCCTCCGAAGG + Intergenic
1065804304 10:29380790-29380812 CAGGAGTCTGGGCTCTCAGCTGG - Intergenic
1065944881 10:30597230-30597252 CAGGAGTCTGGGCTCTCAGCTGG + Intergenic
1069622598 10:69846936-69846958 CGGGAGCCACGGCCCTCATTAGG + Intronic
1070808896 10:79287394-79287416 CTGTACTCAGGGCACTCAGTTGG - Intronic
1072270061 10:93767713-93767735 TGGGAGTCAGGCTCCTCAGTAGG + Intronic
1072613016 10:97031545-97031567 TGGGTGGCAGGACCCTCAGTGGG + Intronic
1075630203 10:123995936-123995958 TGGGAGTCTGGGCACACAGTGGG + Intergenic
1076535997 10:131178116-131178138 AGGGAGGCAGGGTCCTCAGGGGG - Intronic
1076629551 10:131843971-131843993 GGGATTTCAGGGCCCTCAGTGGG + Intergenic
1077472029 11:2768550-2768572 TAGGAGTCAGGGCCCTGAGTTGG - Intronic
1077886633 11:6391944-6391966 CGGTGGTCAGGGCCCGCAGTTGG - Exonic
1078070425 11:8105314-8105336 CTGCAGTCAGGGCCCAGAGTTGG + Exonic
1083949655 11:65947049-65947071 TGGGGGTCAGGGCCCTCTGGGGG + Intronic
1083956142 11:65983930-65983952 TGGGTGTCAGGGCCATCCGTGGG - Intergenic
1084077193 11:66789009-66789031 TTGGAGGCAGGGCCCTCAGGAGG - Intronic
1088129866 11:106474618-106474640 CAGGAGCCAGGGTCTTCAGTGGG + Intergenic
1091676968 12:2498657-2498679 TGGGGGTCAGTGCCCTCTGTGGG + Intronic
1091746489 12:2996129-2996151 CAGGAGTGAGAGCCCTGAGTGGG + Intronic
1091762786 12:3098118-3098140 TAGGAGTCAGGGCCCCCAGCTGG + Intronic
1092160064 12:6311006-6311028 AGGGAGACAGCGCCCTCAGAGGG + Exonic
1098055526 12:66501063-66501085 CAGGAGACAGGGGACTCAGTGGG + Intronic
1101882061 12:108632268-108632290 CCAGAGCCAGGCCCCTCAGTGGG - Intronic
1102683225 12:114704457-114704479 CTGGAGCCAGGGCACTCAGAAGG + Intergenic
1104487888 12:129167511-129167533 CAGGAGTCAGGGGCCTCTGCAGG + Intronic
1106927543 13:34629435-34629457 AGGGAGACTGGGCCCTCACTAGG - Intergenic
1107015463 13:35705264-35705286 TGGGAGTCATGGGCCTCTGTGGG + Intergenic
1110626833 13:77662344-77662366 CAGGAGGCAGGACCCTCTGTGGG + Intergenic
1113628497 13:111864048-111864070 CCTGAGTCAGGGCCCACAGGAGG + Intergenic
1119321163 14:73731338-73731360 AGGGAGTCAGGGCCCTCTGCTGG - Intronic
1119484217 14:74977719-74977741 TGGGAGCCAGGGGCCTCGGTAGG + Intergenic
1119519775 14:75277377-75277399 CGGGGGTCGGGGCCCGCGGTGGG - Intergenic
1120107666 14:80515325-80515347 CAGGAGCCAGGGCCCAGAGTTGG + Intronic
1121907992 14:97765018-97765040 CAGGAGGCAGGGCCCTCAGATGG + Intergenic
1122968387 14:105142653-105142675 CGGGACCCAGGGCCCTCGGTGGG - Exonic
1129460664 15:75698634-75698656 CGGTATCCAGGGCCCACAGTGGG - Intronic
1129640639 15:77373571-77373593 GGGGAGACTGGGCCATCAGTAGG - Intronic
1130984845 15:88838102-88838124 TGGGAGTCAGGGGACTCAGGTGG - Intronic
1135860908 16:26055155-26055177 AGAGGGTCAGGGCCCTCAGCAGG + Intronic
1136367316 16:29814715-29814737 TGGGGGCCAGGGCCATCAGTTGG - Exonic
1137225760 16:46506757-46506779 CGGGAGCCAGGGCCTGAAGTTGG - Intergenic
1137629940 16:49936070-49936092 CGGGAGTCAGGGCTATCATGGGG + Intergenic
1137731482 16:50693611-50693633 CGGGAGTCGTGGCCCGGAGTGGG + Intronic
1138829488 16:60359423-60359445 CAGGAGGCAGGACCCTCTGTGGG + Exonic
1140188742 16:72796570-72796592 CTGGGGTCTGGGGCCTCAGTGGG + Exonic
1142157601 16:88539733-88539755 TGGGAGACAGGGCCGGCAGTGGG - Intergenic
1143378492 17:6480933-6480955 CAGGTGCCAGGGCCCACAGTGGG + Intronic
1146925323 17:36740369-36740391 CGAGAGCCAGAGCCCTCACTTGG - Intergenic
1147661241 17:42118177-42118199 CCGGTGGCAGGTCCCTCAGTGGG + Intronic
1152334937 17:79695429-79695451 GGTGACTCAGGGACCTCAGTAGG - Intergenic
1153092493 18:1363903-1363925 CGGGAGCAAGTGCCCTCAGCTGG + Intergenic
1153995836 18:10440659-10440681 CGGCATTCAGTGCCCTCAGATGG - Intergenic
1157701308 18:49762856-49762878 CTGGGGTCAGGCCCCTCAGACGG - Intergenic
1158328262 18:56333308-56333330 CCAGGGTCACGGCCCTCAGTGGG - Intergenic
1160554522 18:79717099-79717121 CAGGGCTCAGGGCCCTCACTCGG - Intronic
1160554569 18:79717227-79717249 CAGGGCTCAGGGCCCTCACTCGG - Intronic
1160554625 18:79717410-79717432 CAGGGCTCAGGGCCCTCACTCGG - Intronic
1161153865 19:2722368-2722390 CCAGAGTCAGAGCCATCAGTGGG + Intronic
1161201238 19:3016008-3016030 CGGGAGGCGGGGGTCTCAGTGGG - Intronic
1162018511 19:7858120-7858142 CGGGAGGCAGGGCCTTGGGTGGG + Intronic
1162502310 19:11060787-11060809 CGGGAGCCAGGCCCTTCGGTGGG - Intronic
1163530331 19:17844933-17844955 CAGCACTCAGGGCCCTCAGCTGG + Intronic
1163590866 19:18193524-18193546 CAGGGGTCACGGCCCGCAGTCGG - Intronic
1166266202 19:41686185-41686207 GGGGAGTCAGTGTCCTCAGGGGG - Intronic
1168342979 19:55636285-55636307 CGGAGGTCAGTGCCCTCAGGGGG + Intronic
930878237 2:56244198-56244220 TGGGAGTCAGGGCCTGGAGTTGG + Intronic
931215786 2:60243039-60243061 TGGGAGGCAGAGGCCTCAGTGGG - Intergenic
931246092 2:60493923-60493945 GGGGAGACAGGGCCTCCAGTGGG + Intronic
931256453 2:60578118-60578140 GGTGAGTTAAGGCCCTCAGTGGG - Intergenic
932063393 2:68529182-68529204 CAGGAGGCAGGACCCTCTGTGGG + Intronic
933835329 2:86241097-86241119 GGGGAGTCAGGGCCACCAGGAGG + Intronic
937120810 2:119438980-119439002 GGGGAGTCAGGGCCCAGAGAGGG + Intergenic
939162207 2:138604123-138604145 AGGGAATCAGGCCACTCAGTTGG - Intergenic
939429669 2:142086536-142086558 CGGGAGGCAGAGGTCTCAGTGGG + Intronic
942613117 2:177762489-177762511 CAGGAGTCAGGGATCTCACTGGG + Intronic
945236549 2:207636803-207636825 CTGGAGCCAAGGCCCTCAGCTGG + Intergenic
947720035 2:232364781-232364803 TGGGAGTCAGGGCTCTCATTTGG - Intergenic
949041565 2:241852136-241852158 CGGGAGTGAGGGCCGCCAGCAGG + Intronic
1170628632 20:18049262-18049284 AGGGAGTCAGGGCCTTCGGCTGG + Intronic
1174216622 20:48921245-48921267 CGGGAGTAAGGGGCGTCAGGAGG - Intergenic
1175667237 20:60870977-60870999 CTGGAGCCACGGCCCTCAGGAGG - Intergenic
1176137320 20:63529964-63529986 CGGGCTTCAGGGCCCTCCGCGGG - Intronic
1176655522 21:9586091-9586113 CGGCAGTCAGGGCACTCATCTGG - Intergenic
1177900832 21:26913257-26913279 TGTGAGTCAGGGCTCTCAGCTGG - Intergenic
1181475459 22:23165160-23165182 TGGGAGGAAGGGCCCACAGTAGG + Intergenic
1185116467 22:48941033-48941055 CCTGAGTCAGGGCTCACAGTAGG + Intergenic
1185192457 22:49447155-49447177 CGTGACTCAGGGCCCTGGGTTGG - Intronic
953813020 3:46130545-46130567 GGGTAGGCAGGGCCCTCACTAGG + Intergenic
953999316 3:47543315-47543337 CTGGTCTCAGGGCACTCAGTAGG - Intergenic
954296596 3:49677728-49677750 AGGGAGGTAGGGCCCTCAGAAGG - Intronic
954338923 3:49937977-49937999 CAGGAGCCAGGGCCTTCTGTGGG + Intergenic
955219307 3:57010695-57010717 TGGGAGTCAGGGCTCTGAGGAGG - Intronic
957249562 3:77756531-77756553 TATGAGTCAGGGGCCTCAGTTGG - Intergenic
961187272 3:124926619-124926641 GGTGAGTCATGGCCCTCACTGGG + Intronic
961698091 3:128720370-128720392 GGGAAGTCAGGGACCCCAGTGGG + Intergenic
962317995 3:134370814-134370836 CGGGACTCTGGGCCCTCAGCAGG + Exonic
962695556 3:137944023-137944045 CCGGAGTTAGGGCCCTGATTAGG - Intergenic
963745840 3:149124557-149124579 GGGGAGTCAGAGGCCACAGTGGG - Intergenic
968495308 4:912070-912092 GAGGAGGCAGGGCCCTCAGGGGG + Intronic
968616680 4:1580636-1580658 CGGGAGGCGGGGCCCTGAGTTGG - Intergenic
968616693 4:1580673-1580695 CGGGAGGCAGGGTCCTCAGTGGG - Intergenic
968616768 4:1580859-1580881 TGGGAGGCGGGGCCCTGAGTGGG - Intergenic
968616813 4:1580968-1580990 TGGGAGGCGGGGCCCTGAGTGGG - Intergenic
968616858 4:1581077-1581099 TGGGAGGCGGGGCCCTGAGTGGG - Intergenic
968616903 4:1581186-1581208 TGGGAGGCGGGGCCCTGAGTGGG - Intergenic
970232202 4:13922322-13922344 AGGGGGACAGGGCCCTCAGAAGG + Intergenic
974701947 4:65462548-65462570 CAGGAGTCTGGGGCTTCAGTGGG + Intronic
974737231 4:65952329-65952351 TGGGAGTCAGGGGACTTAGTGGG - Intergenic
979451394 4:120875197-120875219 CCTGAGTCAGGGCCCTGGGTTGG - Intronic
983440686 4:167779902-167779924 CGGGAGGCAGGGACCTTAGCAGG - Intergenic
986885172 5:12225682-12225704 CAGGAGTCAGGGCCTGGAGTTGG + Intergenic
990308640 5:54517918-54517940 CGGGAGTCGGGACCGCCAGTCGG + Exonic
990630389 5:57662403-57662425 CTGGTGCCAGGGCCCTCACTGGG + Intergenic
991654874 5:68893991-68894013 CGGGGGTAAGAGCCCTCAGAAGG - Intergenic
994840307 5:104915507-104915529 CAGGAGTCAGTGCCATCATTTGG + Intergenic
995055935 5:107758699-107758721 AGAGACTCAGGGCACTCAGTTGG - Intergenic
995151111 5:108846654-108846676 CGGGAGGCAGAGCTCGCAGTGGG - Intronic
997295660 5:132766776-132766798 CAGGAGTCAGGGCCCCCTGTCGG - Intronic
997538051 5:134638042-134638064 TGGGAGTCAAGGCCCCCAGTGGG - Intronic
997541528 5:134666914-134666936 GGGGCGTGAGGGCCCTCACTGGG - Exonic
1002800182 6:514871-514893 AGGGAGGCAGGGCCCTCTGAGGG + Intronic
1004068530 6:12275198-12275220 CAGGCCTCAGAGCCCTCAGTTGG + Intergenic
1006436497 6:34028405-34028427 CGGGAGTCAGGGCCCTCAGTCGG - Intronic
1008520592 6:52359270-52359292 TGGGAGTAAGAGCCTTCAGTAGG - Intergenic
1008986323 6:57548000-57548022 CTGGGGTCAGGGCCCACAATTGG + Intronic
1009398689 6:63230054-63230076 CAGGAGGCAGGACCCTCTGTGGG + Intergenic
1010305138 6:74310872-74310894 CGGGAGTCAGGGACCCCAAATGG - Intergenic
1012524632 6:100162532-100162554 CAGGACTCAGGGCCATCACTGGG - Intergenic
1017631150 6:156397334-156397356 CCGGAATCAGGGCCCTCCGTCGG + Intergenic
1019183496 6:170207700-170207722 CTGGTCTCAGGGCCCTCAGAGGG - Intergenic
1019414976 7:922925-922947 CGGGGGTCAGGGCTCCCAGTAGG - Intronic
1021842734 7:24733792-24733814 CAGGAGTCAGGGCCTCGAGTTGG - Intronic
1025155311 7:56599961-56599983 CGGAAGTCAGGGACCCCAGATGG - Intergenic
1025282171 7:57635955-57635977 CGGCAGTCAGGGCACTCATCTGG - Intergenic
1025302559 7:57829562-57829584 CGGCAGTCAGGGCACTCATCTGG + Intergenic
1026206065 7:68258576-68258598 AGGGACTCCTGGCCCTCAGTTGG - Intergenic
1026744418 7:72999917-72999939 GGGGAGTCTGGACGCTCAGTAGG - Intergenic
1026804946 7:73423842-73423864 CGGGAGCCAGGGTCCTGCGTTGG + Intergenic
1026946704 7:74320836-74320858 CGTGAGTCAAGGCACCCAGTGGG + Intronic
1027030523 7:74884582-74884604 GGGGAGTCTGGACGCTCAGTAGG - Intergenic
1027099319 7:75365175-75365197 GGGGAGTCTGGACGCTCAGTAGG + Intergenic
1034855214 7:154539191-154539213 TGAGAGGCAGGGCCCACAGTGGG - Intronic
1036663739 8:10725846-10725868 CAGGGGCCATGGCCCTCAGTGGG - Exonic
1037619628 8:20552009-20552031 CTGGAGTGAGGCCCCTCTGTGGG + Intergenic
1046528705 8:115415574-115415596 CTGGAGACAGGGTCCTTAGTAGG + Intronic
1049645155 8:143732890-143732912 TCGAAGTCAGGGCCCTCAGCTGG + Intronic
1049794127 8:144488813-144488835 GGGGAAAGAGGGCCCTCAGTAGG + Intronic
1051455085 9:17246671-17246693 CGGGAGTCAGGGCCTGGAGTCGG + Intronic
1052413272 9:28148246-28148268 CAGGAGACAGGACCCTCTGTGGG - Intronic
1054811997 9:69442349-69442371 CGGGGGTCATAGCCCTCAGTGGG + Intronic
1056020341 9:82432850-82432872 CAGGAGGCAGGACCCTCTGTGGG + Intergenic
1056576480 9:87859002-87859024 CAGAAGGCAGGACCCTCAGTGGG + Intergenic
1057071558 9:92104460-92104482 CAGGAGGCAGGACCCTCTGTGGG - Intronic
1057081679 9:92178437-92178459 TGGGAGGCAGGGCCCACAGCCGG + Intergenic
1057243280 9:93431905-93431927 AGGAAGTCAGGGGGCTCAGTGGG - Intergenic
1059786445 9:117591409-117591431 CCAGAGTCAGGGCCCTGAGAAGG - Intergenic
1061728795 9:132597300-132597322 CGGGAGACAGGGCCTGCGGTTGG + Intronic
1062083058 9:134634525-134634547 GGGGAGTCTGGGCCCTGAGGGGG + Intergenic
1062379154 9:136278471-136278493 GAGGAGTCAGGGCACTCACTGGG - Intergenic
1203633240 Un_KI270750v1:89563-89585 CGGCAGTCAGGGCACTCATCTGG - Intergenic
1192631258 X:72779542-72779564 CAGGAGCCAGGATCCTCAGTTGG + Intronic
1192650451 X:72941259-72941281 CAGGAGCCAGGATCCTCAGTTGG - Intronic
1201777957 Y:17687103-17687125 GGGAAGTCAGGGACCCCAGTTGG + Intergenic
1201823601 Y:18218889-18218911 GGGAAGTCAGGGACCCCAGTTGG - Intergenic