ID: 1006439364

View in Genome Browser
Species Human (GRCh38)
Location 6:34043590-34043612
Sequence CCCATGGCTGGGTGCGTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 216}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006439364_1006439371 -4 Left 1006439364 6:34043590-34043612 CCAAGGACGCACCCAGCCATGGG 0: 1
1: 0
2: 0
3: 13
4: 216
Right 1006439371 6:34043609-34043631 TGGGAGGCTAGCTGGATCTCTGG 0: 1
1: 0
2: 3
3: 230
4: 3456
1006439364_1006439374 16 Left 1006439364 6:34043590-34043612 CCAAGGACGCACCCAGCCATGGG 0: 1
1: 0
2: 0
3: 13
4: 216
Right 1006439374 6:34043629-34043651 TGGGGAAACACACCTCCCCCAGG 0: 1
1: 0
2: 0
3: 12
4: 142
1006439364_1006439376 23 Left 1006439364 6:34043590-34043612 CCAAGGACGCACCCAGCCATGGG 0: 1
1: 0
2: 0
3: 13
4: 216
Right 1006439376 6:34043636-34043658 ACACACCTCCCCCAGGAGGCTGG No data
1006439364_1006439375 19 Left 1006439364 6:34043590-34043612 CCAAGGACGCACCCAGCCATGGG 0: 1
1: 0
2: 0
3: 13
4: 216
Right 1006439375 6:34043632-34043654 GGAAACACACCTCCCCCAGGAGG 0: 1
1: 0
2: 0
3: 13
4: 160
1006439364_1006439373 -2 Left 1006439364 6:34043590-34043612 CCAAGGACGCACCCAGCCATGGG 0: 1
1: 0
2: 0
3: 13
4: 216
Right 1006439373 6:34043611-34043633 GGAGGCTAGCTGGATCTCTGGGG No data
1006439364_1006439372 -3 Left 1006439364 6:34043590-34043612 CCAAGGACGCACCCAGCCATGGG 0: 1
1: 0
2: 0
3: 13
4: 216
Right 1006439372 6:34043610-34043632 GGGAGGCTAGCTGGATCTCTGGG 0: 1
1: 1
2: 0
3: 12
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006439364 Original CRISPR CCCATGGCTGGGTGCGTCCT TGG (reversed) Intronic
900285812 1:1899786-1899808 GCCATGGCTGGGTGGCCCCTTGG + Intergenic
902532850 1:17101565-17101587 CCCAGGGCTGGGCACCTCCTTGG + Intronic
902984780 1:20148792-20148814 CCCAGAGCTGGATGCATCCTCGG + Exonic
904634474 1:31869219-31869241 TTCCTGCCTGGGTGCGTCCTAGG + Intergenic
907460317 1:54601839-54601861 TCCATGCCTGGCTGCGCCCTGGG + Intronic
908794280 1:67815985-67816007 GCCAGGGCTGGGTGCGGCCGGGG + Intronic
910028713 1:82689514-82689536 CCCATGTGTGGCTGAGTCCTGGG + Intergenic
910065336 1:83144210-83144232 CCCATGGGTGGAGGGGTCCTAGG + Intergenic
916368903 1:164066714-164066736 CCCATAGCTGGGTGCCTCTGTGG + Intergenic
920302378 1:204996902-204996924 TCCTTGGCTGGGTGCATGCTGGG + Intronic
922799851 1:228360220-228360242 CCCAAGGCTGTGTGTGTCCTGGG - Intronic
1066676907 10:37897313-37897335 CACATGGCTCGGAGGGTCCTGGG + Intergenic
1066789697 10:39048870-39048892 CCCCTGTCTGGGTGCCTACTAGG + Intergenic
1067045286 10:42981925-42981947 CCCATGGCTCAGTGGGGCCTGGG - Intergenic
1068788500 10:61001855-61001877 CCCAGAGGTGGGTGGGTCCTGGG - Intergenic
1069743565 10:70700606-70700628 CCCCTGCCTAGGTGTGTCCTGGG + Intronic
1069875882 10:71562581-71562603 CCCATGGCTGGGCATGTTCTGGG + Intronic
1071508645 10:86247775-86247797 TTCATGGCTGGGTGCTCCCTGGG - Intronic
1072726102 10:97815194-97815216 CCCTTGGCAGGGTGTGTCCTGGG + Intergenic
1073467851 10:103704697-103704719 CCCAGGGATGGGTGGCTCCTGGG + Intronic
1075066196 10:119290617-119290639 CCAAGGGCTGTGTGAGTCCTTGG - Intronic
1075886418 10:125903340-125903362 CACAGGGCTGGGGGCGTTCTTGG + Intronic
1076924597 10:133475983-133476005 ACCTGGGCTGGGTGCCTCCTGGG + Intergenic
1077167804 11:1151701-1151723 TGCATGGCTGGGTTCCTCCTAGG + Intergenic
1077167819 11:1151753-1151775 TGCATGGCTGGGTTCCTCCTAGG + Intergenic
1077225827 11:1438746-1438768 CCCAGGGCTGGGGACGTCCTGGG - Intronic
1077239511 11:1503203-1503225 CCCATGTCTGGCTGCGGCCCAGG - Intergenic
1084065132 11:66699660-66699682 CCCCTGGGTGGGTCCCTCCTAGG - Intronic
1085018887 11:73192629-73192651 CCCTTGGCTGGGGGCTTCTTAGG - Intergenic
1085392992 11:76191933-76191955 CCCATGGCTGGGTGCTCTCAGGG + Intronic
1090830583 11:130418335-130418357 CCTAGGGCTGGCTGCATCCTAGG + Intronic
1090830587 11:130418352-130418374 CCTAGGGCTGGCTGCATCCTAGG + Intronic
1102003474 12:109573461-109573483 CTCATGGCTGTGTGCGGCCTGGG - Exonic
1103141661 12:118554026-118554048 CCCAGGGCAGGCTGCTTCCTGGG + Intergenic
1105474307 13:20717733-20717755 CCCATGGCTGCGTGGGCCATGGG - Intronic
1109893731 13:68654720-68654742 CCCATGACTGGGAGGGTCCGAGG + Intergenic
1110241414 13:73271303-73271325 CACATTGCTGGGTGCCTCCCAGG + Intergenic
1112509467 13:99997277-99997299 CCCCTGCCAGGGTGCGACCTAGG - Intergenic
1114055313 14:18963253-18963275 CCCAGGCCTGGGTGCCTGCTGGG - Intergenic
1114107232 14:19438523-19438545 CCCAGGCCTGGGTGCCTGCTGGG + Intergenic
1117684336 14:58238044-58238066 TCCATCGATGGGTGAGTCCTTGG - Intronic
1122820462 14:104342212-104342234 CCCCTTACTGGATGCGTCCTTGG - Intergenic
1123666641 15:22613686-22613708 CCCATGGGTGGGCCTGTCCTGGG - Intergenic
1123682609 15:22773516-22773538 CCCATGGGTGGGCCTGTCCTGGG - Intronic
1124320483 15:28708259-28708281 CCCATGGGTGGGCCTGTCCTGGG - Intronic
1124334360 15:28846040-28846062 CCCATGGGTGGGCCTGTCCTGGG - Intergenic
1124482030 15:30087151-30087173 CCCATGGGTGGGCCTGTCCTGGG + Intronic
1124488488 15:30139251-30139273 CCCATGGGTGGGCCTGTCCTGGG + Intronic
1124521560 15:30410052-30410074 CCCATGGGTGGGCCTGTCCTGGG - Intronic
1124537101 15:30556167-30556189 CCCATGGGTGGGCCTGTCCTGGG + Intronic
1124543575 15:30608223-30608245 CCCATGGGTGGGCCTGTCCTGGG + Intronic
1124563528 15:30795677-30795699 CCCATGGGTGGGCCTGTCCTGGG + Intergenic
1124755041 15:32399071-32399093 CCCATGGGTGGGCCTGTCCTGGG - Intronic
1124761548 15:32451424-32451446 CCCATGGGTGGGCCTGTCCTGGG - Intronic
1124777083 15:32597644-32597666 CCCATGGGTGGGCCTGTCCTGGG + Intronic
1124959750 15:34385560-34385582 CCCATGGGTGGGCCTGTCCTGGG - Intronic
1124976376 15:34531781-34531803 CCCATGGGTGGGCCTGTCCTGGG - Intronic
1126410316 15:48367023-48367045 CCCATGTCTGGCTGCCTCCAGGG - Intergenic
1127773837 15:62250825-62250847 CCCATGGGTGGGCCTGTCCTGGG - Intergenic
1127774776 15:62256200-62256222 CCCATGGGTGGGCCTGTCCTGGG - Intergenic
1127775370 15:62260426-62260448 CCCATGGGTGGGCCTGTCCTGGG - Intergenic
1128724132 15:69975358-69975380 CCCAGGGCTGACTGCATCCTAGG - Intergenic
1129029584 15:72608652-72608674 CCCATGGGTGGGCCTGTCCTGGG + Intergenic
1129037527 15:72659686-72659708 CCCATGGGTGGGCCTGTCCTGGG + Intronic
1129212360 15:74077539-74077561 CCCATGGGTGGGCCTGTCCTGGG - Intronic
1129398038 15:75263540-75263562 CCCATGGGTGGGCCTGTCCTGGG + Intronic
1129401649 15:75287821-75287843 CCCATGGGTGGGCCTGTCCTGGG + Intronic
1129475238 15:75780528-75780550 CCCATGGGTGGGCCTGTCCTGGG + Intergenic
1129839025 15:78732113-78732135 CCCATGGGTGGGCCTGTCCTGGG + Intergenic
1130416881 15:83702506-83702528 CCCTTGGCTGTGTGCATCCTAGG + Intronic
1131173029 15:90191838-90191860 CTCAGGGCTGGGAGCTTCCTTGG - Intronic
1131833339 15:96368097-96368119 CACAGGGCTGGTTGGGTCCTCGG + Intergenic
1131872958 15:96779685-96779707 CCCAGGGCTGTCTGCGTCCCAGG + Intergenic
1132373002 15:101310829-101310851 CCCATGGCTGGCTGCCAGCTGGG - Intronic
1132607700 16:800412-800434 CCCGTGGCTGGGGGCGTCCACGG - Intronic
1132648761 16:1011005-1011027 ACGCTGGCTGAGTGCGTCCTAGG + Intergenic
1133241225 16:4415857-4415879 GCCACGGCTGGGTGGGGCCTGGG - Intronic
1133270689 16:4609646-4609668 TCCATGGCAGGGTGGGCCCTGGG + Exonic
1133345165 16:5065011-5065033 CACAGGGCTGGGTGCTTCCTGGG - Intronic
1137382698 16:48013657-48013679 GCCATGGCTGGCTGCACCCTGGG - Intergenic
1137391939 16:48088666-48088688 CCCACGGCTGGGCCAGTCCTTGG + Exonic
1137527066 16:49245767-49245789 ACCAAGGCTGGGGGCTTCCTAGG - Intergenic
1138009270 16:53362537-53362559 CCCATGGGTGGGCCTGTCCTGGG - Intergenic
1138563330 16:57815266-57815288 CCCAAGGCTGTGGGGGTCCTGGG + Intronic
1138860006 16:60744453-60744475 CCCAGTGCTGGGTGCAGCCTAGG - Intergenic
1140041750 16:71412763-71412785 CCCATGTCAGGGTGAGTGCTGGG + Intergenic
1142141186 16:88473543-88473565 CCCATGGCCGGGCCCATCCTGGG + Intronic
1142482926 17:229688-229710 GCCATGGATGAGTGGGTCCTGGG + Intronic
1143140596 17:4739916-4739938 CCCCGGGCTCGGTGCGTCCGCGG - Intronic
1144735652 17:17553943-17553965 CCCCTGGCTGGGTGTGCTCTGGG - Intronic
1145055224 17:19698806-19698828 TCCATGGCTGGTTGCATCCACGG - Intronic
1145738081 17:27247551-27247573 CCCAGGGCCTGGTGCATCCTGGG + Intergenic
1147044436 17:37742856-37742878 CGCCTGGCTGGGTGCGCGCTGGG + Intronic
1148102971 17:45103947-45103969 CCCATGGGAGGCTGCGTCCCGGG - Intronic
1148243206 17:46013295-46013317 GCCATGGCTGTGTGGGGCCTGGG - Intronic
1150606081 17:66692108-66692130 CCCAAGGCTGTGAGCATCCTGGG + Intronic
1151786454 17:76277362-76277384 CCCATGGGTGGGTGAGTCCCAGG - Intronic
1152034533 17:77864043-77864065 CTCCAGGCTGGGTGCGGCCTGGG - Intergenic
1153369432 18:4297339-4297361 CCCATGGCATGGAGCGTCTTAGG - Intronic
1154412047 18:14146845-14146867 CCCATGGCTCGGTCTGTCGTGGG - Intergenic
1157229726 18:45903961-45903983 TCCTTTGCTGGGTGGGTCCTGGG - Exonic
1158404676 18:57150886-57150908 CTCTGGGCTGGGTGGGTCCTGGG + Intergenic
1160601378 18:80015051-80015073 CCCCTTGCTGTGTGCGGCCTAGG - Intronic
1161345499 19:3767094-3767116 CCCTGGGCTGGGTGGGTCCCTGG - Intronic
1161551424 19:4914969-4914991 CCTCTGGCTGGGACCGTCCTGGG + Intronic
1161721951 19:5907897-5907919 CACATGGCTGGGGGTGGCCTCGG - Intronic
1162070193 19:8148524-8148546 CCCTTGGCTGGGTCTTTCCTGGG + Intronic
1162421338 19:10567704-10567726 CCCATATCTGGGGGCGTCTTTGG - Intronic
1162817689 19:13206392-13206414 CCCTTGGCTAGGTGCTGCCTGGG - Intergenic
1163390739 19:17028306-17028328 CCCAGGGCTTGGTGCTGCCTGGG - Intergenic
1164673181 19:30084714-30084736 CCCAGGGCTGTGGGCTTCCTTGG + Intergenic
1165161780 19:33820666-33820688 CCCATGGGTGGGTCCATCCCCGG + Intergenic
1167145038 19:47676305-47676327 GCCATGGCAGGGTGTGACCTAGG + Intronic
927890051 2:26742547-26742569 CCCATGGGAGGTGGCGTCCTAGG - Intergenic
927963778 2:27257018-27257040 CTCATGTCTGGGAGAGTCCTGGG + Intronic
932614538 2:73223548-73223570 GCCATGGCTGGGTGAGGCCAAGG - Intronic
932760592 2:74436748-74436770 CCCAAGGCCGGGAGCGCCCTAGG + Intronic
934761739 2:96860487-96860509 CTCATGGCCGGGTGGGTGCTGGG + Exonic
935327415 2:101949168-101949190 GCAATGGCTGAGTGAGTCCTGGG + Intergenic
936916301 2:117642141-117642163 CCCATGGCTGTGTGCTTACCCGG - Intergenic
937780663 2:125833312-125833334 AACATGGCTGGGTGTGTCGTAGG + Intergenic
937884376 2:126889977-126889999 CCTGTGGCTTGGTGAGTCCTGGG - Intergenic
938473329 2:131586032-131586054 CCCAGGCCTGGGTGCCTGCTGGG - Intergenic
938740544 2:134227639-134227661 CCCATTCCTGGGTGTGACCTTGG + Intronic
938762527 2:134438764-134438786 CCCAGGGCTGTATGGGTCCTGGG + Intronic
938839343 2:135144033-135144055 CCCAGGGCTGAGTGAGGCCTGGG - Intronic
941289953 2:163662625-163662647 CCCAGTGCTGGGTGCAGCCTAGG + Intronic
944148015 2:196527140-196527162 CACCTGGCTGGGAGGGTCCTAGG - Intronic
946402831 2:219477515-219477537 TCCAGGGCTGGCTGCTTCCTGGG - Intronic
948920624 2:241064371-241064393 CCCACCCCTGGGTGTGTCCTCGG - Intronic
1171163520 20:22950435-22950457 ACCATTGCTAGGTGCCTCCTCGG - Intergenic
1172331726 20:34080172-34080194 CCCAAGCCTGGGAGTGTCCTGGG - Exonic
1172770908 20:37382071-37382093 CCCCTGACTGGCTGGGTCCTCGG - Intronic
1174115636 20:48224733-48224755 CCCATGACTCAGTGCCTCCTGGG - Intergenic
1176118839 20:63445170-63445192 CCCAGGGCTGAGTCCGTCCCTGG + Intronic
1180473793 22:15685805-15685827 CCCAGGCCTGGGTGCCTGCTGGG - Intergenic
1180703112 22:17792454-17792476 CCCTTGGCAGGGGGCGTTCTAGG + Intronic
1180855600 22:19042907-19042929 GCCAGGGCTGGGTGCGTCAGGGG - Intronic
1181737191 22:24891572-24891594 CCCATGCCTGGTGGCTTCCTGGG + Intronic
1182466581 22:30520539-30520561 TCCATGGCTGGGCACGACCTTGG - Intergenic
1183623081 22:38986160-38986182 GCCATGGCTGGGGGTGTCCCAGG + Intronic
1183633092 22:39045289-39045311 GCCATGGCTGGGGGTGTCCCAGG + Intronic
1184718708 22:46296806-46296828 CGGCGGGCTGGGTGCGTCCTGGG - Exonic
1185270444 22:49927117-49927139 CCCTTGGATGGCTGCGTCCGGGG + Intronic
1185366180 22:50437960-50437982 CCCATGGCTCGGTCTGTCATGGG + Intronic
950940361 3:16885037-16885059 CCCATGGCGGAGTGCGGCCGGGG + Intronic
955146377 3:56324273-56324295 ACCAAGGCTGGGTGAGTCATGGG - Intronic
961781080 3:129320336-129320358 CCCATGGCTGGCTCCTTCCCTGG + Intergenic
963335939 3:143973001-143973023 GCCAGGGCAGGGGGCGTCCTGGG + Intronic
964231774 3:154478490-154478512 CCCATGCCAGGGTGCGAGCTTGG + Intergenic
966917501 3:184593146-184593168 CCCAAGGCTGGGCTCCTCCTGGG - Intronic
967469600 3:189846486-189846508 CCCATGGGCTGGTGCTTCCTGGG + Intronic
968439674 4:617001-617023 CCCATGACTGGGTGCCCCCGTGG + Intergenic
968482857 4:844401-844423 CCCATGGCTGGGTAGGTCTCAGG + Intergenic
968689337 4:1982615-1982637 GCCAGGGCTGGGGGCTTCCTAGG - Intergenic
969501344 4:7555353-7555375 ACCATGGCTGGGGGTGTCTTTGG - Intronic
971576978 4:28286998-28287020 CACATGGCTGTGTGGGGCCTGGG - Intergenic
971662149 4:29432764-29432786 CCTATGGCTGGGTCAGTGCTTGG - Intergenic
973891530 4:55372310-55372332 CCCCTGACAGGGTGCGTCATGGG - Exonic
977014646 4:91677807-91677829 CCCATTGCTGTGTGCAGCCTAGG + Intergenic
979302098 4:119098309-119098331 CCCATGGTTGGGTGTGCCTTTGG + Intergenic
981483869 4:145264365-145264387 CCCACTGCTGTGTGGGTCCTTGG + Intergenic
986029779 5:3883176-3883198 CCCATGCCTGGGGCCCTCCTGGG - Intergenic
986393218 5:7304052-7304074 CCCATGGGTGGGCCTGTCCTGGG - Intergenic
986533173 5:8760356-8760378 CCCCTTGCTGTGTGCATCCTAGG + Intergenic
986963623 5:13244459-13244481 CCCATGGCTGGGGGAGGCTTGGG - Intergenic
997543069 5:134680768-134680790 GCCAGGGCTGGGTGTGTTCTCGG - Intronic
998003600 5:138642934-138642956 GCCAAGGCTGGCTGGGTCCTAGG + Intronic
998130320 5:139648496-139648518 CGCATGGCTGGGCGCGGGCTGGG - Exonic
998786165 5:145711381-145711403 CCCATGGCTGCTTTCATCCTTGG + Intronic
1001696836 5:173676443-173676465 CCCAAGGCAGGGTGTCTCCTGGG + Intergenic
1002563569 5:180098162-180098184 CCCATGGGTGGGTGAGTCAGTGG + Intergenic
1004172970 6:13312917-13312939 CCCATGGTTGGTTGAGTCCATGG - Intronic
1004267337 6:14160241-14160263 CCCAAGGGTGGGTGCTTCCTGGG + Intergenic
1006439364 6:34043590-34043612 CCCATGGCTGGGTGCGTCCTTGG - Intronic
1007493491 6:42242953-42242975 CCCAAGGCTGGGACCATCCTTGG + Intronic
1007716302 6:43858116-43858138 CCCCAGGCTGGCTGCCTCCTGGG + Intergenic
1008153393 6:47984277-47984299 CTCATGGCTGGGTGGGACTTAGG + Intronic
1009945948 6:70341813-70341835 CCCATTGCTGTGTGCAGCCTTGG - Intergenic
1013546215 6:111160544-111160566 CCCATGGCCGAGTGAGTCCCTGG - Intronic
1018962775 6:168459802-168459824 CCCCGGGCTGGGTGAGCCCTGGG + Intronic
1019496077 7:1341257-1341279 CCCATGGCTGGGGACTTCTTTGG + Intergenic
1020107588 7:5429279-5429301 TCCTTGGCTGAGGGCGTCCTTGG - Intergenic
1020278413 7:6637806-6637828 CTCCTGGATGGGTGTGTCCTGGG - Intronic
1020731551 7:11887665-11887687 CCCATTGCTGTGTGCAGCCTAGG + Intergenic
1021890613 7:25182417-25182439 CCCATGGCTTGATTCTTCCTGGG + Intergenic
1023713671 7:43021501-43021523 CCCATGTCAGGGTGCATGCTTGG - Intergenic
1024346795 7:48321879-48321901 CACATGGCTGTGGGAGTCCTGGG + Intronic
1025085442 7:56019717-56019739 CCCATGGCTCGCCGTGTCCTAGG + Exonic
1027278770 7:76590536-76590558 CCCATGGGTGGAGGGGTCCTAGG - Intergenic
1029282008 7:99441402-99441424 CCCATGGCTAGGTGTGTCCCGGG - Intronic
1033218695 7:139513285-139513307 GCCTTGGCTGGGTGAGTTCTTGG - Intergenic
1034427834 7:151023917-151023939 CCCGTGGATGGGTGAGTCTTGGG + Exonic
1034964624 7:155383618-155383640 CTCCTGGCTGGGTGCGGTCTCGG + Intronic
1035376352 7:158409403-158409425 CTCATGCCTGGGTAGGTCCTGGG - Intronic
1037835594 8:22213142-22213164 CCCATGCCAGGCTGCTTCCTGGG - Intergenic
1039972380 8:42331202-42331224 CCCACGGAGGGCTGCGTCCTGGG - Exonic
1041313645 8:56540359-56540381 CCCAGGGCTGTGTGCGATCTGGG + Intergenic
1048201308 8:132376422-132376444 CCCAGGGCTGGGTGAGTTATTGG - Intronic
1049038866 8:140097702-140097724 CGCCTGTCTGGGTGGGTCCTTGG + Intronic
1049191685 8:141291824-141291846 TCCTTGGCTGGGTCTGTCCTGGG - Intronic
1049363799 8:142226793-142226815 CCCATGGCAGGGCCCTTCCTAGG + Intronic
1049593443 8:143472814-143472836 CCCAGGTCGCGGTGCGTCCTTGG - Intronic
1049708546 8:144053646-144053668 CCCATTGCTGGCTGCTCCCTTGG - Intronic
1050355885 9:4782285-4782307 CGCATTTCTGGGTGTGTCCTGGG + Intergenic
1051735871 9:20198592-20198614 CTCATGGCTGGGTGGGTGTTGGG + Intergenic
1053002732 9:34586182-34586204 CCCAGGGCTGGCTGCATCCTAGG + Intronic
1053005867 9:34604100-34604122 CCCATGGCTTAGTCCGTCTTTGG - Intergenic
1053049020 9:34943159-34943181 CACATCCCTGGGTGGGTCCTGGG - Intergenic
1053537299 9:38938253-38938275 CCGAGGGCAGGGTGCGTGCTGGG + Intergenic
1054628836 9:67425677-67425699 CCGAGGGCAGGGTGCGTGCTGGG - Intergenic
1058222989 9:102325759-102325781 CTCACTGCTGTGTGCGTCCTCGG + Intergenic
1059334920 9:113563031-113563053 CCCATGGCTGGAGGAGCCCTGGG - Intronic
1060915933 9:127390720-127390742 CCCCTGGCTTGGGGCCTCCTTGG - Exonic
1061048179 9:128178621-128178643 CCCCTGACTGGGTGCTGCCTGGG - Intronic
1061063973 9:128266106-128266128 CCCATGGGTGGGCCTGTCCTGGG - Intronic
1061272037 9:129549299-129549321 TTCCTGGCTGGGTGTGTCCTTGG - Intergenic
1061369471 9:130190266-130190288 CCAATGGCTGGGTGCTCCATGGG - Intronic
1061741299 9:132708360-132708382 CCCATGTCTGGGAGCTCCCTCGG + Intergenic
1061925253 9:133803059-133803081 CCCAAGGCTGGGTGGTTCCAGGG - Intronic
1062115652 9:134806735-134806757 CCCATGGCTGGGCTCTTCCTAGG + Intronic
1062212667 9:135373108-135373130 CACATGTCTGGGTGTGTCCCTGG - Intergenic
1062607428 9:137354456-137354478 CCCCTGGCAGGGTACATCCTTGG + Intronic
1187018689 X:15357333-15357355 CCCATGGAGGGCAGCGTCCTGGG - Intronic
1190054965 X:47175988-47176010 CCCATGGATGGCTGGGTCCTGGG - Intronic
1190134384 X:47782162-47782184 CACATGGCTCGGAGGGTCCTAGG + Intergenic
1190277739 X:48910086-48910108 GCCATGGCTAGGAGGGTCCTGGG - Intronic
1192802541 X:74480265-74480287 TGCATGGCTGGGAGGGTCCTAGG - Intronic
1197167216 X:123391672-123391694 CGGATGGGTGGGTGGGTCCTTGG + Intronic
1198051835 X:132958163-132958185 CCCATGGCCAGGTACGTTCTAGG - Exonic