ID: 1006439412

View in Genome Browser
Species Human (GRCh38)
Location 6:34043788-34043810
Sequence GAGGCAGGTTACCCTGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 186}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006439412_1006439421 -3 Left 1006439412 6:34043788-34043810 CCCTCACCAGGGTAACCTGCCTC 0: 1
1: 0
2: 1
3: 16
4: 186
Right 1006439421 6:34043808-34043830 CTCCACCCAGGGCAGCTCTGGGG 0: 1
1: 0
2: 6
3: 49
4: 465
1006439412_1006439425 2 Left 1006439412 6:34043788-34043810 CCCTCACCAGGGTAACCTGCCTC 0: 1
1: 0
2: 1
3: 16
4: 186
Right 1006439425 6:34043813-34043835 CCCAGGGCAGCTCTGGGGGAAGG No data
1006439412_1006439428 18 Left 1006439412 6:34043788-34043810 CCCTCACCAGGGTAACCTGCCTC 0: 1
1: 0
2: 1
3: 16
4: 186
Right 1006439428 6:34043829-34043851 GGGAAGGGCTCCAGAGTGCTAGG 0: 1
1: 0
2: 2
3: 27
4: 274
1006439412_1006439418 -5 Left 1006439412 6:34043788-34043810 CCCTCACCAGGGTAACCTGCCTC 0: 1
1: 0
2: 1
3: 16
4: 186
Right 1006439418 6:34043806-34043828 GCCTCCACCCAGGGCAGCTCTGG No data
1006439412_1006439422 -2 Left 1006439412 6:34043788-34043810 CCCTCACCAGGGTAACCTGCCTC 0: 1
1: 0
2: 1
3: 16
4: 186
Right 1006439422 6:34043809-34043831 TCCACCCAGGGCAGCTCTGGGGG 0: 1
1: 0
2: 2
3: 43
4: 304
1006439412_1006439427 3 Left 1006439412 6:34043788-34043810 CCCTCACCAGGGTAACCTGCCTC 0: 1
1: 0
2: 1
3: 16
4: 186
Right 1006439427 6:34043814-34043836 CCAGGGCAGCTCTGGGGGAAGGG 0: 1
1: 0
2: 4
3: 61
4: 809
1006439412_1006439420 -4 Left 1006439412 6:34043788-34043810 CCCTCACCAGGGTAACCTGCCTC 0: 1
1: 0
2: 1
3: 16
4: 186
Right 1006439420 6:34043807-34043829 CCTCCACCCAGGGCAGCTCTGGG No data
1006439412_1006439430 25 Left 1006439412 6:34043788-34043810 CCCTCACCAGGGTAACCTGCCTC 0: 1
1: 0
2: 1
3: 16
4: 186
Right 1006439430 6:34043836-34043858 GCTCCAGAGTGCTAGGCCTCGGG No data
1006439412_1006439429 24 Left 1006439412 6:34043788-34043810 CCCTCACCAGGGTAACCTGCCTC 0: 1
1: 0
2: 1
3: 16
4: 186
Right 1006439429 6:34043835-34043857 GGCTCCAGAGTGCTAGGCCTCGG 0: 1
1: 0
2: 0
3: 26
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006439412 Original CRISPR GAGGCAGGTTACCCTGGTGA GGG (reversed) Intronic
900585650 1:3431159-3431181 GAGGGAGGTCCCCCTCGTGATGG - Intronic
901953016 1:12763452-12763474 GAGGGAGATTACCCAGCTGAAGG + Exonic
902722308 1:18312033-18312055 AAGGAAGGTGAACCTGGTGATGG - Intronic
903154445 1:21434565-21434587 GAGGCAGGTGTCCCTGCAGAAGG + Intergenic
903354783 1:22740020-22740042 GAGGCAGGGAGGCCTGGTGAGGG + Intronic
904423706 1:30410136-30410158 GAGGCATGATGCCCTGGTCAGGG - Intergenic
905343553 1:37295751-37295773 GAGCCAGGTGACCCTAGGGAAGG + Intergenic
907159826 1:52361777-52361799 AAGGAAGGTTTCCCTGTTGAGGG - Intronic
908768355 1:67573799-67573821 GATGCAGTTTACCGTGGTCAAGG - Intergenic
910166042 1:84328623-84328645 GAGGCAGGTTAACATGGTAGAGG - Intronic
911376955 1:97062735-97062757 GAGGAAGGGAACCCTGGTCATGG + Intergenic
914241313 1:145854868-145854890 GGGGAAGGTAACCCTGGAGAAGG + Exonic
915170285 1:153972826-153972848 GAAGCATGTTACCTTGGTGAGGG - Exonic
915931744 1:160065016-160065038 GAGTCAGACTGCCCTGGTGAGGG + Intronic
915952472 1:160198716-160198738 GAGGAAGCTGATCCTGGTGAGGG + Exonic
916159075 1:161890717-161890739 GATGCAGGTCAGCCTGCTGAAGG + Intronic
916481440 1:165218225-165218247 GAGGCAGGAAACACTGCTGATGG + Intronic
917651035 1:177077747-177077769 GAGGCAGCTTACCCCAGAGAGGG - Intronic
919792914 1:201303926-201303948 GGGGCAGGTCACCTCGGTGAGGG - Intronic
920178427 1:204117586-204117608 AAGGCATGTTAACCTGCTGAAGG - Exonic
922534848 1:226372157-226372179 GAGTCAGGTTCCCCTGGTGCTGG + Intronic
923800050 1:237200170-237200192 GAGGCAGCATAGCCTGGTGAAGG - Intronic
1065115180 10:22477314-22477336 GAGGCAGGGTCCTCTGGTGGAGG - Intergenic
1068760768 10:60706352-60706374 GAGGGAGGTTACCTTGGGGCTGG - Intronic
1069742907 10:70696853-70696875 GATGCAGGTGGCCCTGTTGAGGG + Intronic
1069867917 10:71515056-71515078 CAGGGAGGTGACCCTGGTGCTGG + Intronic
1073443208 10:103564926-103564948 GAGGGGGGTCACCCTGATGAAGG + Intronic
1074362444 10:112834193-112834215 GAGGCTGGTGGCCTTGGTGAGGG - Intergenic
1076674638 10:132141700-132141722 GAGAAAGGTTTCCCTGGGGAGGG - Intronic
1078850578 11:15159213-15159235 GAGGCAAGGTACCCAAGTGATGG + Intronic
1079075674 11:17384163-17384185 GAGGAAGGTTACTCTGGTTTGGG + Intergenic
1079610967 11:22432451-22432473 AAGGAAGGTTGCCATGGTGATGG + Intergenic
1080507623 11:32932450-32932472 GAAGGAGGATACCCTGATGATGG - Exonic
1080991744 11:37545316-37545338 GAGGCAGGTTCCCATGGTCTTGG + Intergenic
1083300667 11:61738213-61738235 GAGGCAGGGTGCCCAGGTGGGGG - Intronic
1084790480 11:71472640-71472662 GAGGCAGGTTCCTATAGTGAGGG + Intronic
1085718472 11:78893229-78893251 CAGGCAGATAACCCTGCTGATGG + Intronic
1088949349 11:114551041-114551063 GAGGCACGTCACACAGGTGAGGG + Intronic
1090880094 11:130825516-130825538 GAGGCAGATTTCCCTGGCCAAGG - Intergenic
1091228882 11:133974959-133974981 GCTGCAGGTCACCCTGGTGTGGG + Intergenic
1093410088 12:18854556-18854578 CAGGCATGTTCCCATGGTGATGG + Intergenic
1094236704 12:28176400-28176422 GATGCAGATTGCCCTGGTTAAGG - Intronic
1096610264 12:52796294-52796316 GTGGCAGGCTTACCTGGTGAGGG + Intergenic
1098011128 12:66053491-66053513 GTGGAAGTTAACCCTGGTGAAGG - Intergenic
1098078477 12:66758842-66758864 GAGGCAGGTTCCCATGGTCTTGG + Intronic
1100963197 12:99985161-99985183 GAGGCTGGTGACACTGGGGAGGG + Intergenic
1102908449 12:116694888-116694910 GAGGCAGGTGACCCTTGGCAAGG + Intergenic
1108259664 13:48644133-48644155 GAAGCAGGTGCCCCAGGTGAAGG - Intergenic
1110048219 13:70858976-70858998 GATGCAGGTTGCCCAGGGGAAGG - Intergenic
1113032722 13:106012669-106012691 GAGGCAGGTGATGTTGGTGATGG - Intergenic
1114481965 14:23041648-23041670 GAGGCAGGAGACCTTGGTGCTGG - Intergenic
1115096997 14:29649263-29649285 GAGGCAGGTAGCCTTGGTAAAGG + Intronic
1115269837 14:31539492-31539514 GAGGCAGGTGACGGAGGTGAGGG + Intronic
1117092216 14:52262640-52262662 GGGGCAGGTTGCCCTGGGGAAGG - Intergenic
1117244820 14:53874371-53874393 GAAGCTGTTTACCCTGGAGAAGG - Intergenic
1117612791 14:57501888-57501910 GAGGCAGGTCTCCTTGGTGCTGG + Intergenic
1119650771 14:76381323-76381345 GAGGCAGGCTGGCCCGGTGAGGG - Intronic
1119869327 14:78001904-78001926 GGGGCAGGTTCCCCTGATAAGGG + Intergenic
1122308901 14:100782538-100782560 GAGGCAAGGTCCCCTGGTGGGGG + Intergenic
1124205562 15:27716079-27716101 GAGACATGTTACCATGGAGATGG - Intergenic
1124632517 15:31345633-31345655 AGGGCAGGGTCCCCTGGTGAGGG - Intronic
1125389728 15:39178974-39178996 GAGGCAGCTTATCCTAATGATGG + Intergenic
1126421611 15:48479134-48479156 CCGTCAGGTTACCTTGGTGATGG - Intronic
1129668287 15:77591982-77592004 GAGGCAGGCCAGGCTGGTGAGGG + Intergenic
1132945171 16:2528370-2528392 GCCGCAGCTTACCCTGGGGATGG - Exonic
1133810090 16:9154944-9154966 CAGGCACGTTTCCCTGGAGAGGG + Intergenic
1134196921 16:12166432-12166454 TAGCCAGGTTAACATGGTGAAGG + Intronic
1135475891 16:22774551-22774573 GAGGCAGGTGGCCCTGGGGAGGG + Intergenic
1138231874 16:55343780-55343802 GATGCAGGCTTCCCTGGGGAGGG - Intergenic
1139011471 16:62639857-62639879 GAAGCAGTTTACCATGGTAAGGG - Intergenic
1140650458 16:77082621-77082643 GATGCAGGTGTCTCTGGTGATGG + Intergenic
1140847523 16:78904585-78904607 GAGGCAGGCTGACCTGGGGAAGG - Intronic
1141409025 16:83819802-83819824 GTGGCAGCTTAACCTGCTGAGGG - Intergenic
1142624523 17:1183350-1183372 CAGGCAGGTCACCCTGGGGTTGG - Intronic
1142899531 17:3003641-3003663 GATGCAGGTGACTCTGGGGAAGG - Intronic
1143008205 17:3850915-3850937 GAGGCAGCTGACCCTGGTGGGGG + Intergenic
1146059285 17:29596096-29596118 GAGCCAGGTTTCCCTGGTCTTGG + Intronic
1146468509 17:33106192-33106214 GAGCCAGGTTAACAAGGTGAGGG + Intronic
1147119395 17:38327009-38327031 GAGGCAGTCTGCCCTGGGGAAGG - Exonic
1149282344 17:55121695-55121717 GAGGCAGGCTACCCCTGAGAGGG - Intronic
1151700043 17:75737938-75737960 GAGGCTGGGGACCCTGGTGGGGG - Intronic
1153769244 18:8401897-8401919 GCAGCAGGTTGCCCTGGTTACGG + Intronic
1155047221 18:22113580-22113602 GAGGCAGGTCACCCTGGCGCAGG - Intergenic
1155244508 18:23894507-23894529 GAAGCAGGGTCCCCTGCTGAAGG - Intronic
1156547167 18:37975400-37975422 GGGGCATGTTAGGCTGGTGAGGG + Intergenic
1160618335 18:80151009-80151031 GAGGAAGGGTCCCCTGGGGAAGG + Intronic
1160750125 19:730041-730063 GAAGCAGGCTGCCCTGGGGAGGG - Intronic
1161838018 19:6660957-6660979 GAGGGAGGTGGCCCTGATGAGGG - Intergenic
1162420379 19:10562733-10562755 GAGGAAGGTTATCTTGGAGAAGG - Exonic
1162530132 19:11231135-11231157 GGTACAGGTTACCTTGGTGATGG + Intronic
1163648250 19:18502376-18502398 GAGGGAGGTGTCCCAGGTGAGGG + Intronic
1163884721 19:19955486-19955508 GAGGCAGGACACCCAGGTGTGGG + Intergenic
1164204325 19:23045274-23045296 GAGTCACGTTACCCGGGTAATGG + Intergenic
1165103814 19:33456932-33456954 GACGCAGGTTTCACTGGAGAGGG - Intronic
1165223110 19:34333791-34333813 GAGGCACGTTACCATGTGGATGG - Exonic
1166422896 19:42652476-42652498 GGGCCAAGTGACCCTGGTGAGGG - Intronic
1167415021 19:49365499-49365521 GAAGCAGGTTACCCTGGGGCCGG - Exonic
1168353046 19:55687373-55687395 GAGGCTGGGTGCTCTGGTGATGG + Intronic
925658094 2:6171526-6171548 GTGGCAGGTTGCCCTAGTGAAGG - Intergenic
925805090 2:7640924-7640946 GAGGTAGGTTACCATGGTCTTGG + Intergenic
928108313 2:28487232-28487254 TAGAAAGGTCACCCTGGTGATGG + Intronic
931728710 2:65134225-65134247 GAGGCAGCTTAGCCTGGGAATGG + Intergenic
934616146 2:95772483-95772505 GAGGCAGGCAACCCTGGGGCCGG + Intergenic
934644752 2:96052077-96052099 GAGGCAGGCAACCCTGGGGCCGG - Intergenic
934838164 2:97608166-97608188 GAGGCAGGCAACCCTGGGGCCGG - Intergenic
939300772 2:140334575-140334597 CAGAGAGGTTAGCCTGGTGATGG + Intronic
939568650 2:143814225-143814247 GAAGCAGCATAACCTGGTGATGG + Intergenic
940000392 2:148961581-148961603 TAGGCAGGTAAATCTGGTGATGG + Intronic
942323192 2:174753770-174753792 CAGGCAGGTCACCCTGATGAGGG + Intronic
942842566 2:180380069-180380091 GATAAAGGTTACTCTGGTGAAGG + Intergenic
943355397 2:186849204-186849226 CAGGCTGGTTGCCTTGGTGACGG + Intronic
948919096 2:241053015-241053037 GAGGCACCTTTCCCCGGTGAAGG + Intronic
1169593896 20:7176561-7176583 GAGGTAGGTTCCCATGGTGTTGG + Intergenic
1170297452 20:14843981-14844003 GAGGCAGGACAGCTTGGTGATGG - Intronic
1170334271 20:15250688-15250710 GAGGCAGGTAACTCAGGTGAAGG - Intronic
1171757218 20:29121802-29121824 AATGCAGCTTCCCCTGGTGATGG + Intergenic
1173433588 20:43012920-43012942 GAGGCAGGTCAAGCAGGTGAGGG - Intronic
1175334638 20:58187282-58187304 GAGCCAGGTGACATTGGTGAGGG + Intergenic
1175711397 20:61224187-61224209 AGAACAGGTTACCCTGGTGAGGG - Intergenic
1175970488 20:62684443-62684465 GAGGCAGCGTAGCCTGGTGGGGG - Intronic
1178062267 21:28865094-28865116 GAGGCAGGTTAATCAGGAGATGG - Intergenic
1178177300 21:30117723-30117745 TAGAGAGGTTAACCTGGTGAAGG - Intergenic
1179536521 21:42056216-42056238 GAGGCAGATGACCCGGGGGAGGG - Intergenic
1180000962 21:44995355-44995377 GAGGCAGGTTCCCCTGCAGCCGG - Intergenic
1181426458 22:22845123-22845145 GTGTCAGGTTAACCTGATGAAGG - Intronic
1184518925 22:44980802-44980824 AGGGCATGTTACCCTTGTGAAGG - Intronic
1185163839 22:49245559-49245581 CAGGCAGGCTAACATGGTGAGGG - Intergenic
950664148 3:14484792-14484814 GAGGCAGATGGCCCTGGCGAAGG + Intronic
954831261 3:53423109-53423131 GATGCAGGCTGCCCTGGTAAAGG + Intergenic
956272012 3:67458036-67458058 GAGGCTGGTTACTTTGCTGAAGG + Intronic
959604024 3:108222439-108222461 GAGTCTAGTTTCCCTGGTGACGG - Exonic
960324058 3:116273330-116273352 GAGGCAGGTTTCCCACTTGAGGG - Intronic
960583458 3:119300037-119300059 GAGGCAGGTGCCCCTGCTGGAGG + Intronic
967155560 3:186688593-186688615 GAGACAGGTTTCCCTGGTACTGG + Intergenic
967156892 3:186701051-186701073 GAGACAGGTTCCCCTGGTACTGG + Intergenic
967455452 3:189680941-189680963 GTGCCAGGGTACACTGGTGAAGG + Intronic
968163692 3:196447552-196447574 AAGCAAGGTTACCTTGGTGATGG - Intergenic
969110961 4:4844054-4844076 GAGGGAGGTTACCCTAGCAACGG - Intergenic
971258719 4:25036520-25036542 CAGGCACATTACACTGGTGATGG - Intergenic
976435762 4:85016194-85016216 GAGGCAGGTGATCCTAGGGAGGG - Intergenic
977646322 4:99416812-99416834 GGGGCAGGTTACACTTGTGCAGG - Intronic
979994632 4:127415818-127415840 GAGGTTGTTTACCCTTGTGATGG - Intergenic
981420036 4:144538915-144538937 GAGGCAGGTGATGGTGGTGATGG - Intergenic
987889707 5:23861330-23861352 CATGCAGGCTGCCCTGGTGAGGG + Intergenic
991005711 5:61826014-61826036 GAGGCAGGTTATCCTACTGAGGG - Intergenic
991149090 5:63345279-63345301 GAGGCAGATTACCCCTGTGGAGG + Intergenic
993843073 5:92905284-92905306 GAGGCAACTTGCCCTAGTGATGG - Intergenic
996603790 5:125296892-125296914 CAGGCAGGATATCCTAGTGAAGG + Intergenic
997375359 5:133393819-133393841 GAGCCAGCTTTCCCTGGAGAAGG + Intronic
998251998 5:140559669-140559691 GAGGGAAGTTAGCCAGGTGAAGG - Intronic
1000367774 5:160506848-160506870 GATGCAGGTTGCCATGGTGACGG - Intergenic
1005845392 6:29772876-29772898 GAGGCAGGTTACCCTGGGAAAGG - Intergenic
1005850722 6:29818579-29818601 GAGTCAGGTTACCCTGGGAAAGG - Intergenic
1005857557 6:29873989-29874011 GAGGTAGGTTACCCTGGGAAAGG - Intergenic
1005863358 6:29918103-29918125 GAGGTAGGTTACCCTGGGAAAGG - Intergenic
1006439412 6:34043788-34043810 GAGGCAGGTTACCCTGGTGAGGG - Intronic
1007284768 6:40739662-40739684 GAGGCAGGTGACTGAGGTGATGG - Intergenic
1007295775 6:40819479-40819501 TAAGCAGGCTGCCCTGGTGAAGG - Intergenic
1007760686 6:44131938-44131960 GAGGCAGAATACCTTGGGGATGG - Intronic
1008400086 6:51054005-51054027 GAGGCTGGGTCCCCTTGTGAAGG + Intergenic
1009763686 6:68040265-68040287 GTGGCAGCTGACCGTGGTGAGGG + Intergenic
1011385389 6:86791875-86791897 AATGAAAGTTACCCTGGTGATGG - Intergenic
1011868846 6:91866938-91866960 AAGGCAGTTTACACTTGTGAAGG - Intergenic
1012015325 6:93842655-93842677 GAGGCAGGTCACTTTGGTCAAGG - Intergenic
1014007472 6:116436435-116436457 GAGGTAAGCTGCCCTGGTGATGG - Exonic
1017648303 6:156558819-156558841 GATGGAGGCTGCCCTGGTGATGG + Intergenic
1018983475 6:168617733-168617755 GAGCCAGGAGACCCTGATGATGG - Intronic
1018997010 6:168717572-168717594 GAGGCAGGCTAGCCTGGGAAGGG - Intergenic
1024505636 7:50159079-50159101 GAGACAGGGGAGCCTGGTGACGG - Exonic
1025030394 7:55552086-55552108 GAGCCAGGTTAGCCAGGTCAGGG + Intronic
1026019543 7:66696889-66696911 GGTGCAGGTTCCCTTGGTGATGG + Intronic
1026307135 7:69151953-69151975 GAGGAAGGTTATGCTGATGAAGG + Intergenic
1028257044 7:88611612-88611634 GAGGAAGGTAACACTGGTAAGGG + Intergenic
1030611019 7:111688837-111688859 CAGGGAGGTTAAACTGGTGATGG + Intergenic
1031062567 7:117068632-117068654 GATGCAGTTAACCTTGGTGAAGG - Intronic
1032955960 7:136972752-136972774 GTGGCAGGTGACGATGGTGACGG + Intronic
1032955967 7:136972786-136972808 GTGGCAGGTGACGATGGTGACGG + Intronic
1032955974 7:136972820-136972842 GTGGCAGGTGACGATGGTGACGG + Intronic
1032955981 7:136972854-136972876 GTGGCAGGTGACGATGGTGACGG + Intronic
1032955988 7:136972888-136972910 GTGGCAGGTGACGATGGTGACGG + Intronic
1032955995 7:136972922-136972944 GTGGCAGGTGACGATGGTGACGG + Intronic
1032956002 7:136972956-136972978 GTGGCAGGTGACGATGGTGACGG + Intronic
1032956009 7:136972990-136973012 GTGGCAGGTGACGATGGTGACGG + Intronic
1032956016 7:136973024-136973046 GTGGCAGGTGACGATGGTGACGG + Intronic
1032956023 7:136973058-136973080 GTGGCAGGTGACGATGGTGACGG + Intronic
1038665841 8:29537154-29537176 GAGGCAGGCTAACTTGCTGAGGG + Intergenic
1041181375 8:55252649-55252671 GAGGCAGTGTATCCTGGGGATGG - Intronic
1046506693 8:115146321-115146343 GAGGCAGGTTCCCATGGTCTTGG + Intergenic
1049237720 8:141520661-141520683 GAGGCGAGTCACCCTGGAGAAGG + Intergenic
1050541396 9:6673602-6673624 GATGCAGGTGACAGTGGTGAGGG + Intergenic
1050585410 9:7105983-7106005 GAGGCAGCTTTTCCTGATGAGGG + Intergenic
1055478217 9:76684703-76684725 GAGGCAATCTACCCTGGTGGGGG + Intronic
1059909656 9:119028080-119028102 GAGGCAGATGCCCCTGGTGGAGG - Intergenic
1060413376 9:123414320-123414342 GAGGCAGGGAAACCTGCTGATGG - Intronic
1061688681 9:132306107-132306129 GAGGCAGGGTTCCCTCGTTATGG - Intronic
1062037184 9:134387641-134387663 GAGGCAGGTGGTCCTGGTCAAGG - Intronic
1202801280 9_KI270720v1_random:1543-1565 AATGCAGCTTCCCCTGGTGATGG - Intergenic
1203772021 EBV:54271-54293 GAGGCAGGTTAGCCTGGCCTGGG + Intergenic
1187724731 X:22190604-22190626 GTGGCAGGGTATGCTGGTGAAGG + Intronic
1193732570 X:85118429-85118451 GAAGAAGGTAACCCTGGAGAAGG + Intergenic
1194662182 X:96639512-96639534 GAGGTAGGTTCCCATGGTGTTGG - Intergenic
1196462802 X:115947422-115947444 CAGGCAGGTGACCATGGTGGGGG - Intergenic
1198827309 X:140712997-140713019 GAGGCTGGTTTCCCTGGCAATGG + Intergenic
1202591986 Y:26494531-26494553 GAGGCAGGTTGCCCTAATGGTGG + Intergenic