ID: 1006441134

View in Genome Browser
Species Human (GRCh38)
Location 6:34054395-34054417
Sequence CAGATGAACTCCGCCCGCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006441131_1006441134 3 Left 1006441131 6:34054369-34054391 CCAAGCTGGTCTTGAACTCCTGA 0: 1987
1: 55821
2: 127462
3: 175169
4: 193633
Right 1006441134 6:34054395-34054417 CAGATGAACTCCGCCCGCCTCGG 0: 1
1: 0
2: 1
3: 6
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006441134 Original CRISPR CAGATGAACTCCGCCCGCCT CGG Intronic
900438312 1:2641666-2641688 CAGAAGTCCTCTGCCCGCCTTGG + Exonic
903865400 1:26393962-26393984 CAGGTGATCCCCCCCCGCCTCGG - Intergenic
904752187 1:32747871-32747893 CAGGTGATCCCCTCCCGCCTTGG - Intronic
905329930 1:37187426-37187448 CAGATGACCTGGGCCAGCCTGGG + Intergenic
905335571 1:37242360-37242382 CAGATGATCTCTTCCCTCCTAGG + Intergenic
905594308 1:39192872-39192894 CAGGTGATATCCACCCGCCTCGG - Intronic
905856973 1:41320689-41320711 CAGATGTACTCAGGCAGCCTGGG + Intergenic
914677562 1:149916488-149916510 CAGGTGAAGTCAGCCAGCCTAGG - Intronic
915417774 1:155755300-155755322 CTGAAGTAATCCGCCCGCCTTGG + Intronic
915743123 1:158134916-158134938 CAGAAGAATTCCTCCCACCTGGG + Intergenic
916102022 1:161400747-161400769 TAGGTGAGATCCGCCCGCCTCGG - Intergenic
918077463 1:181181475-181181497 CTCCTGAACTCTGCCCGCCTTGG + Intergenic
921228999 1:213050051-213050073 CTGAGGTAATCCGCCCGCCTCGG + Intergenic
924638235 1:245808986-245809008 CTCCTGACCTCCGCCCGCCTCGG + Intronic
1064233125 10:13547520-13547542 CTCCTGAACTCCACCCGCCTCGG - Intergenic
1072190254 10:93072355-93072377 CAGAAGCACGCCGCACGCCTTGG - Intergenic
1076383487 10:130040595-130040617 CAGCTGACCTCCACCCACCTCGG - Intergenic
1080015733 11:27505097-27505119 CTTAGGAAGTCCGCCCGCCTCGG - Intronic
1083057496 11:59837049-59837071 CAGATGTACTCTGCCCACATGGG + Intronic
1083563099 11:63689991-63690013 CAAGTGAACTGCCCCCGCCTCGG + Intronic
1084316643 11:68349594-68349616 CAGGTGAACTCAGCCAGACTAGG - Intronic
1088399599 11:109408575-109408597 CAGATGATCTGCCCCTGCCTTGG + Intergenic
1089269564 11:117292415-117292437 CAAATGATCTGCCCCCGCCTTGG + Intronic
1093562290 12:20555245-20555267 CACAGGAAATCCGCCCGCCTTGG + Intronic
1099122103 12:78703537-78703559 CTGAGGCAATCCGCCCGCCTCGG + Intergenic
1101940351 12:109095207-109095229 CTGAAGAAATCCGCCTGCCTTGG + Intergenic
1102206128 12:111091951-111091973 CTGATTAAATCCACCCGCCTTGG + Intronic
1103785807 12:123432128-123432150 CAGGTGACCTGCGCCCACCTCGG + Intronic
1103966046 12:124640310-124640332 CAGCTCAACTCGGCTCGCCTGGG + Intergenic
1105353559 13:19637556-19637578 CTGATAAAATCCACCCGCCTCGG + Intronic
1112550492 13:100416413-100416435 CTCAAGTACTCCGCCCGCCTCGG + Intronic
1114991926 14:28298383-28298405 CAGATGATCTCCCACGGCCTTGG - Intergenic
1117143234 14:52810796-52810818 CAGGTGATCCGCGCCCGCCTCGG + Intergenic
1118709170 14:68505784-68505806 CTCAGGAAATCCGCCCGCCTCGG + Intronic
1130720175 15:86378813-86378835 CAGGTGAACTCCTCCAACCTGGG - Intronic
1131459872 15:92610464-92610486 CAGAAGGATTCAGCCCGCCTAGG - Intergenic
1133027683 16:2995769-2995791 CAGGTGAGCCCCGCCCGCCCTGG + Intergenic
1133122462 16:3618494-3618516 CAGAGGTAATCCGCCCGCCTTGG - Intronic
1142002613 16:87672079-87672101 CAGGTGAACCCCGCCCGGCGAGG - Intronic
1142668549 17:1476406-1476428 CAGGTGATCTCTGCCCACCTAGG + Intronic
1146939822 17:36836638-36836660 CAGGTGATCCCCACCCGCCTTGG - Intergenic
1147384994 17:40075773-40075795 CAGGGGAACTCAGCCCACCTAGG - Intronic
1148570612 17:48665435-48665457 CTGATGTAATCCGCCTGCCTCGG + Intergenic
1149304203 17:55332827-55332849 AAGGTGCACTCCACCCGCCTGGG - Intergenic
1151361512 17:73592077-73592099 CAGATGAAGTCCGGAAGCCTGGG - Intronic
1151610902 17:75174154-75174176 CACAAGTAATCCGCCCGCCTTGG - Intergenic
1151816707 17:76474700-76474722 CAGATGATGTCCCCCAGCCTGGG + Intronic
1152738172 17:82007612-82007634 CAGGGGTACTCTGCCCGCCTGGG + Intronic
1162371593 19:10283402-10283424 CAGACGAACTGCACCTGCCTGGG - Intronic
1162499619 19:11044809-11044831 CAGATGCACTCAGCTCTCCTGGG - Intronic
1163454833 19:17400390-17400412 CTGAAGAAATCCACCCGCCTCGG - Intergenic
1164477355 19:28585854-28585876 CAGACGAACTCCACATGCCTTGG + Intergenic
1167050882 19:47077618-47077640 CAGGTGATCCACGCCCGCCTTGG - Intronic
927355966 2:22173583-22173605 CTCATGAGCTCCGTCCGCCTTGG + Intergenic
928157367 2:28888823-28888845 CAGATGATCCGCGCCCACCTTGG - Intergenic
929856558 2:45643013-45643035 CATTTGACCTCCGCCTGCCTGGG + Intergenic
930126612 2:47803149-47803171 CTCGTGAACTCTGCCCGCCTAGG + Intronic
934528487 2:95068593-95068615 CTGATGAAATCCTCCAGCCTAGG - Intergenic
941307173 2:163884594-163884616 CAAGTGATCCCCGCCCGCCTCGG - Intergenic
944654410 2:201863616-201863638 CAGAAGTGATCCGCCCGCCTCGG - Intronic
947213530 2:227729177-227729199 CTCCTGAACTCCGCCCGCCTCGG - Intergenic
947761613 2:232607350-232607372 CAGGTGATCCCCACCCGCCTCGG - Intronic
948267357 2:236644789-236644811 CAGATGAGCTCTGCCCTCCCAGG + Intergenic
948725804 2:239933222-239933244 CAGAGGAACTCTGCCCACCCAGG + Intronic
948787129 2:240358564-240358586 CAGATGACCCCGGCCCTCCTTGG - Intergenic
1168877414 20:1181110-1181132 GAGATGTACTACGCCCGCCTAGG - Exonic
1168952594 20:1812618-1812640 CAGATGAACTCTGCCCTCAGTGG + Intergenic
1172198319 20:33107355-33107377 CAGATGATCTGCCCCCACCTCGG - Intronic
1172462328 20:35129029-35129051 CAGGTGATCTCCACCCACCTTGG - Intronic
1173762150 20:45572165-45572187 CTGATGAGATCCGCCCGCCTCGG - Intronic
1174185585 20:48703722-48703744 GAGAGGAAGTCCGCCAGCCTGGG + Intronic
1177694279 21:24552232-24552254 CAGAGGTAATCCGCCCACCTCGG - Intergenic
1183632084 22:39039739-39039761 CTGAGGAGATCCGCCCGCCTTGG - Intergenic
1183729210 22:39607889-39607911 CAGGTGACCCCCCCCCGCCTTGG - Intronic
1183815528 22:40296861-40296883 CAAGTGATCTCCGCCCGACTTGG + Intronic
951556369 3:23924633-23924655 CAGGTGATCTGCGCCCGTCTTGG + Intronic
954039847 3:47877108-47877130 CTGATGTGATCCGCCCGCCTTGG + Intronic
954680395 3:52342927-52342949 CAGGTGAGCTCCTCCAGCCTCGG - Intronic
965075768 3:163973712-163973734 CAGGTGATCTCTGCCTGCCTCGG + Intergenic
968162701 3:196439835-196439857 CAGGTGATCCCCGCCCACCTCGG + Intergenic
968557155 4:1251391-1251413 CAGATGACCACCGCCCTCCAGGG + Intergenic
968767933 4:2484060-2484082 CAGGTGATCCCCCCCCGCCTCGG + Intronic
969562796 4:7960179-7960201 CAGATGGTCTCCGTCCCCCTGGG - Intergenic
970333852 4:15011332-15011354 CTCATGTAATCCGCCCGCCTCGG + Intronic
972274081 4:37541049-37541071 AAGGTGAACTCAGCCAGCCTGGG - Intronic
974092011 4:57321391-57321413 GAGATGAAGTCAGCCCTCCTGGG - Intergenic
976102715 4:81582380-81582402 CAAGTGATCCCCGCCCGCCTAGG + Intronic
983394785 4:167180133-167180155 CAAATGAACTCAGCCTTCCTTGG + Intronic
984077700 4:175204541-175204563 CTGAAGCACTCCTCCCGCCTTGG + Intergenic
984887801 4:184466282-184466304 CTCAGGAAATCCGCCCGCCTCGG + Intronic
991681333 5:69142759-69142781 CAGATGTGATCCGCCTGCCTTGG + Intergenic
993073365 5:83194177-83194199 CAGATGAACTCCACCTGCCTTGG + Intronic
999179868 5:149661982-149662004 CAGGAGCAATCCGCCCGCCTCGG - Intergenic
1001766169 5:174248896-174248918 CAGATGATCCGCGCCCCCCTCGG - Intergenic
1002144061 5:177164706-177164728 CAGGTGATCTCCACCCACCTTGG - Intronic
1002145145 5:177174446-177174468 CAGATGATCGCCTCCCACCTTGG + Intronic
1002396658 5:178961580-178961602 CTGAGGCAATCCGCCCGCCTTGG - Intronic
1002523929 5:179805686-179805708 CAGCTGGACTCAGCCCGCTTAGG + Intronic
1004502746 6:16223494-16223516 CCGCTGCACTCCGCCAGCCTTGG + Intergenic
1006441134 6:34054395-34054417 CAGATGAACTCCGCCCGCCTCGG + Intronic
1010241383 6:73618958-73618980 CACAGGCAATCCGCCCGCCTCGG + Intronic
1016449458 6:144166757-144166779 CTGATGTGATCCGCCCGCCTTGG + Intronic
1016608817 6:145964644-145964666 CTCAGGAAATCCGCCCGCCTCGG - Intergenic
1017916145 6:158833270-158833292 CAGGTGATCTCCGCCTGCCTTGG + Intergenic
1018046226 6:159968974-159968996 CAGGTGACCCCCGCCCGCCCCGG - Intergenic
1026949543 7:74338266-74338288 CTCAAGAAATCCGCCCGCCTTGG - Intronic
1029501922 7:100936611-100936633 CTCCTGACCTCCGCCCGCCTCGG + Intergenic
1029516313 7:101025556-101025578 CTCATGCAATCCGCCCGCCTTGG - Intronic
1030884782 7:114923089-114923111 CAGCTGGCCGCCGCCCGCCTCGG - Exonic
1035731592 8:1857335-1857357 CAGATGAACATCACCCGGCTGGG - Intronic
1045318719 8:101065195-101065217 CAGATGAACCCCTCTGGCCTGGG + Intergenic
1045515429 8:102855291-102855313 CTCATGTAATCCGCCCGCCTTGG + Intronic
1047057555 8:121182946-121182968 CTGAGGCAATCCGCCCGCCTTGG + Intergenic
1047454310 8:124995463-124995485 CTGAGGCAATCCGCCCGCCTCGG - Intergenic
1049422930 8:142524859-142524881 CAGATGAGCTGCGGCAGCCTGGG + Intronic
1054790662 9:69253676-69253698 CTCCTGACCTCCGCCCGCCTCGG + Intronic
1055055664 9:72021747-72021769 CACAGGTAATCCGCCCGCCTCGG + Intergenic
1055318931 9:75063075-75063097 CTCCTGACCTCCGCCCGCCTCGG - Intronic
1055504621 9:76935230-76935252 CTGAAGCAATCCGCCCGCCTTGG + Intergenic
1061689171 9:132311198-132311220 CTGGTGATCCCCGCCCGCCTCGG + Intronic
1062338554 9:136083288-136083310 GAGATGACCTCCGCGTGCCTAGG - Intronic
1186987686 X:15034410-15034432 CAGATGAACTCAGAACTCCTTGG + Intergenic
1190326514 X:49210140-49210162 CAGATGCACACCGCCCCCATTGG + Intronic
1200185224 X:154178269-154178291 CTCCTGACCTCCGCCCGCCTCGG - Intergenic
1200190877 X:154215407-154215429 CTCCTGACCTCCGCCCGCCTCGG - Intergenic
1200196628 X:154253209-154253231 CTCCTGACCTCCGCCCGCCTCGG - Intergenic
1200202283 X:154290327-154290349 CTCCTGACCTCCGCCCGCCTCGG - Intronic