ID: 1006445851

View in Genome Browser
Species Human (GRCh38)
Location 6:34079382-34079404
Sequence CTGGCTAAACTGTTGTTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 103}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006445851_1006445854 -4 Left 1006445851 6:34079382-34079404 CCCTGCAACAACAGTTTAGCCAG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1006445854 6:34079401-34079423 CCAGAGACACAAGAGATTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006445851 Original CRISPR CTGGCTAAACTGTTGTTGCA GGG (reversed) Intronic
902080042 1:13814547-13814569 CTGGTTAAACCTTTGTTGCGGGG + Intronic
903599580 1:24526055-24526077 CTTGCTAATCGGTTCTTGCATGG + Intronic
905166463 1:36086002-36086024 CTGGCTGACCTTCTGTTGCAAGG - Exonic
908397965 1:63743616-63743638 CTGGCTTAACTCTTGCTGCCTGG - Intergenic
910896863 1:92078989-92079011 CTAGCTAAATGGTTGTTGTAAGG + Intergenic
912848767 1:113103243-113103265 CTTGCTAAACTGGTTTTACAGGG - Intronic
917012666 1:170491605-170491627 CAGGCTAAACTGCAGTGGCATGG - Intergenic
920313277 1:205061000-205061022 CTGGCTCCAGGGTTGTTGCAGGG + Intronic
921139295 1:212290841-212290863 ATGGCTAAACTGAAGTTGAAAGG - Intronic
1063256135 10:4329247-4329269 CTTGCTAAACTGACTTTGCAGGG + Intergenic
1074320704 10:112399297-112399319 CTGCCAAAACTGTTGTTAAAGGG + Intronic
1076369780 10:129944979-129945001 CTTGGTAAACTGATTTTGCAAGG + Intronic
1078882377 11:15464791-15464813 CTGTTTAAACTTTTGTTGAAAGG - Intergenic
1078999076 11:16735333-16735355 CTGCCCAAACTGTTTTTTCAAGG + Intronic
1079492331 11:21002605-21002627 CAGGGTAGACTGTTGTTGGATGG - Intronic
1079879903 11:25913672-25913694 TTGTCTAAATTCTTGTTGCAGGG + Intergenic
1079968260 11:27005164-27005186 CTTCCTAAAGGGTTGTTGCAAGG - Intergenic
1081402610 11:42660629-42660651 ATGGCTAAACTCATGTTACAGGG - Intergenic
1083852059 11:65373986-65374008 CTTGCTAAACTGTTGCAACAAGG + Intergenic
1087258902 11:95988485-95988507 GAGGCTAAACTGTTGTTCAAAGG + Intronic
1091885940 12:4017065-4017087 CTTGCTAAACTGACTTTGCAAGG + Intergenic
1095762663 12:45857353-45857375 CTTGCTAAACTGTTCTTTTATGG - Intronic
1100351133 12:93784001-93784023 CTCGCCAAACTCTTGCTGCAGGG + Intronic
1103028688 12:117594707-117594729 CTGGTTTAACTCTTGTTGCGGGG - Intronic
1106891725 13:34253423-34253445 CTGGTTAAACAGTTATTACAGGG + Intergenic
1107696038 13:43001215-43001237 CTGGCCAAAATTTAGTTGCATGG + Intergenic
1108246032 13:48515196-48515218 CTAGGTTACCTGTTGTTGCAAGG + Exonic
1112278706 13:98044266-98044288 CTGGCTAAACTGACTTAGCAGGG + Intergenic
1113160587 13:107376266-107376288 CTAGTTAAACTGTTGTTTTAAGG + Intronic
1113676473 13:112210410-112210432 CTTGCTAAACTGACTTTGCAGGG + Intergenic
1114784016 14:25573209-25573231 TTGCCTAAACTGGTGTTGAATGG + Intergenic
1117248055 14:53906195-53906217 ATGGCGAAACTGTCCTTGCAGGG - Intergenic
1129210146 15:74063716-74063738 CTGGCCAACCTGTACTTGCATGG + Intergenic
1129403876 15:75301686-75301708 CTGGCCAACCTGTACTTGCATGG - Intergenic
1131339710 15:91586371-91586393 CTGGCTAAAATGTTGTGGTATGG + Intergenic
1138816664 16:60210676-60210698 CTGTCTTAACTCTTGTTGCCTGG + Intergenic
1139291854 16:65866462-65866484 CTGGATAAATTGTAGCTGCATGG - Intergenic
1144451898 17:15388109-15388131 CTTGCTGAACTGTTACTGCATGG + Intergenic
1146228871 17:31091279-31091301 CTGGTCAAACTGGTGTTCCATGG + Intergenic
1153587056 18:6633267-6633289 CTCGCTAGAATATTGTTGCAGGG + Intergenic
1157077700 18:44483711-44483733 CTGGATACAGTGTTGTTGCATGG - Intergenic
1160005809 18:75068265-75068287 CTGGCTAAACCGATTTGGCAGGG + Intergenic
1168443758 19:56393984-56394006 CTGGTAAAACTGTTGTTCCACGG - Intergenic
925133871 2:1512960-1512982 CAAGCCTAACTGTTGTTGCACGG + Intronic
925216804 2:2103490-2103512 ATGGCCAAGCTGTTGTTGAATGG - Intronic
927064777 2:19460467-19460489 CTTGCTAAACTGATTTAGCAGGG - Intergenic
928187119 2:29121204-29121226 TTGGCAAAACTGTTGTTAAAAGG - Intronic
929963255 2:46512344-46512366 CTGGATAAACTGGTGCTCCAGGG - Exonic
930406105 2:50957492-50957514 CTGGGTAAATTTTTGTTGTAGGG - Intronic
934607038 2:95703684-95703706 ATGGTTAAATAGTTGTTGCAGGG + Intergenic
936440887 2:112552010-112552032 TTGTCTAAACTGTTTTTGGAGGG + Intronic
942686101 2:178533607-178533629 CTGAATATACTGTTGTGGCAAGG - Exonic
943218114 2:185065473-185065495 CTGGCTGAACTGACTTTGCAGGG + Intergenic
947047690 2:226006601-226006623 CTGGCTACACTGATGATGGAAGG - Intergenic
947099789 2:226607593-226607615 CTGACTAAATTTTTGTTGAAAGG + Intergenic
948211199 2:236194584-236194606 TTGGCTTAACTGTTGTTGAAAGG + Intergenic
1175159382 20:56996402-56996424 CTGATTATAGTGTTGTTGCAAGG + Intergenic
1185236630 22:49717314-49717336 CTGTGTAAACAGTTGTTACACGG + Intergenic
949974283 3:9440800-9440822 CTGGCTAATCTGTTATTCCATGG - Intronic
951575653 3:24111113-24111135 CTGGCTCATCTGCTTTTGCAGGG + Intergenic
951705264 3:25537877-25537899 CTGCCTATTTTGTTGTTGCATGG + Intronic
952875061 3:37937772-37937794 CTTGCTAAACTGATTTAGCAGGG + Intronic
954685535 3:52368190-52368212 CTGGCTAAACTGACTTAGCAGGG + Intronic
955191917 3:56769573-56769595 CTTGCTGAACTGTGGCTGCAAGG + Intronic
955302054 3:57789540-57789562 CTGGCTAAACTGACTTAGCAAGG + Intronic
959449362 3:106480536-106480558 CTGGCGTAACTGTTCTTGCTGGG - Intergenic
960019359 3:112932247-112932269 CTGGCTATACATTTGCTGCATGG + Intronic
960449318 3:117786997-117787019 ATGGGTAAAGTGATGTTGCATGG - Intergenic
963845302 3:150149540-150149562 CTGGCAAAACTGTTTTTATAAGG - Intergenic
964040905 3:152260863-152260885 ATAGCTAAACTGGTGGTGCAAGG - Intronic
965724924 3:171705057-171705079 CTGGCTCACCTCCTGTTGCATGG + Intronic
966538978 3:181067898-181067920 CTGCTTAAACTGTTGTTGCTGGG - Intergenic
967776231 3:193388885-193388907 ATCTCTAAACTGATGTTGCAAGG + Intergenic
971586978 4:28416568-28416590 CTGGCTAAACAATTGTGGGAGGG - Intergenic
975907545 4:79232370-79232392 CTTTCTAAAATGTTGTGGCATGG + Intronic
977788860 4:101073994-101074016 CTGGGAAAACTGTTGTTACGGGG + Intronic
978163016 4:105571856-105571878 CTGGCAAAAATGTTATTCCAAGG - Intronic
978803418 4:112776202-112776224 CTTGCTAATCTTTTGTTACAGGG - Intergenic
984279336 4:177650159-177650181 CTTGCTAAACTGATTTAGCAGGG - Intergenic
989500468 5:42160665-42160687 CTGAATAAAATGTTGTTGAATGG + Intergenic
991531074 5:67615593-67615615 CTGGCTAAAATTTTGTTACATGG - Intergenic
992668439 5:79034623-79034645 CTGGCTAAGTTGTTGTTGTTGGG - Intronic
993870656 5:93250084-93250106 CTGGCTTATCAGTTGTTTCAGGG + Intergenic
993953361 5:94202048-94202070 CTGGCTAAACTGATTTAGCAAGG + Intronic
994317643 5:98350864-98350886 CTGGATAAAGTGTTTTTGAATGG - Intergenic
994786200 5:104167264-104167286 CTGGCTAAACTCTCATTGAACGG - Intergenic
996598657 5:125235005-125235027 TTGGATAAACTGTTGATGAAAGG + Intergenic
997594904 5:135100648-135100670 CTTGCTAAACTGCTGTGGGAAGG + Intronic
998055946 5:139077476-139077498 CTCCCTAAACTGTTGTTTTACGG + Intronic
998446515 5:142203048-142203070 CTGGCTAAACTGTCTTGGGAAGG + Intergenic
1000273403 5:159709423-159709445 CTTGCTAAACTGATTTAGCAGGG + Intergenic
1006445851 6:34079382-34079404 CTGGCTAAACTGTTGTTGCAGGG - Intronic
1009598103 6:65762523-65762545 CTAGCACAACTGTTGTTGGAGGG - Intergenic
1012502333 6:99902714-99902736 CTGGCTGAACACTTGTTGGAAGG + Intergenic
1014144702 6:117984024-117984046 CTGTTTAAACTGTTGTTGGAGGG - Intronic
1020591120 7:10138447-10138469 CTGGCTAAACTGATTTAGCCAGG - Intergenic
1022992243 7:35720042-35720064 CTGGCTTAAAGGTAGTTGCAAGG + Intergenic
1030320354 7:108160933-108160955 GAGGCTAAACTGTCCTTGCAAGG + Intronic
1031346364 7:120671741-120671763 CTGGCAAAACAGTGGTTGAAAGG - Intronic
1031891147 7:127294479-127294501 CTGGCTAAAGTGTTGCATCAGGG - Intergenic
1033993000 7:147311101-147311123 CTGGCTAAACTGACTTCGCAGGG + Intronic
1039733925 8:40309599-40309621 CTGGCTAAACTGACTTAGCAGGG - Intergenic
1039734251 8:40313927-40313949 CTGGCTAAACTGACTTAGCAGGG - Intergenic
1039850340 8:41359170-41359192 CTGGCTAACCTGATTTAGCAGGG + Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1045752590 8:105503140-105503162 CAGTCTTAACTGTTGTTTCAAGG + Intronic
1051351614 9:16203090-16203112 CTGGCAAAGCTCTTGCTGCACGG + Intergenic
1054778718 9:69146827-69146849 CTGGATAATTCGTTGTTGCAGGG - Intronic
1056954010 9:91068004-91068026 TTCGCTGAAATGTTGTTGCATGG - Intergenic
1189784454 X:44546784-44546806 CTGGATAAAATGTTGTTTCTTGG - Intergenic
1192614237 X:72601578-72601600 CTGGCTAAACTGACTTAGCAGGG + Intronic
1194062281 X:89218485-89218507 CTGGCTAAACTGGCTTAGCAGGG - Intergenic
1198896466 X:141461065-141461087 GTGGCCAAAGTGTAGTTGCAGGG - Intergenic