ID: 1006447626

View in Genome Browser
Species Human (GRCh38)
Location 6:34088754-34088776
Sequence GGGTGTTTCACCTAGCCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006447619_1006447626 13 Left 1006447619 6:34088718-34088740 CCCATCTGCAAAATGGGAAAAAA 0: 1
1: 2
2: 45
3: 368
4: 1867
Right 1006447626 6:34088754-34088776 GGGTGTTTCACCTAGCCACATGG No data
1006447620_1006447626 12 Left 1006447620 6:34088719-34088741 CCATCTGCAAAATGGGAAAAAAA 0: 1
1: 0
2: 48
3: 382
4: 2374
Right 1006447626 6:34088754-34088776 GGGTGTTTCACCTAGCCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006447626 Original CRISPR GGGTGTTTCACCTAGCCACA TGG Intronic
No off target data available for this crispr