ID: 1006451672

View in Genome Browser
Species Human (GRCh38)
Location 6:34109119-34109141
Sequence AACCCTTCCTTGCTGCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 260}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006451668_1006451672 4 Left 1006451668 6:34109092-34109114 CCTAGGCCCATCAATGCCAAAGA 0: 1
1: 0
2: 1
3: 13
4: 146
Right 1006451672 6:34109119-34109141 AACCCTTCCTTGCTGCTGCCTGG 0: 1
1: 0
2: 0
3: 21
4: 260
1006451670_1006451672 -3 Left 1006451670 6:34109099-34109121 CCATCAATGCCAAAGATCGAAAC 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1006451672 6:34109119-34109141 AACCCTTCCTTGCTGCTGCCTGG 0: 1
1: 0
2: 0
3: 21
4: 260
1006451669_1006451672 -2 Left 1006451669 6:34109098-34109120 CCCATCAATGCCAAAGATCGAAA 0: 1
1: 0
2: 0
3: 10
4: 122
Right 1006451672 6:34109119-34109141 AACCCTTCCTTGCTGCTGCCTGG 0: 1
1: 0
2: 0
3: 21
4: 260
1006451665_1006451672 30 Left 1006451665 6:34109066-34109088 CCTCAGCTGCCAGCAGCTGACTG 0: 1
1: 0
2: 3
3: 45
4: 389
Right 1006451672 6:34109119-34109141 AACCCTTCCTTGCTGCTGCCTGG 0: 1
1: 0
2: 0
3: 21
4: 260
1006451666_1006451672 21 Left 1006451666 6:34109075-34109097 CCAGCAGCTGACTGAAGCCTAGG 0: 1
1: 0
2: 2
3: 12
4: 204
Right 1006451672 6:34109119-34109141 AACCCTTCCTTGCTGCTGCCTGG 0: 1
1: 0
2: 0
3: 21
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006451672 Original CRISPR AACCCTTCCTTGCTGCTGCC TGG Intronic
900292269 1:1928558-1928580 CACCCTTCCCTGCTCCCGCCTGG + Intronic
900356450 1:2267368-2267390 ACCCCTTCCTTGCTCCTCACAGG - Intronic
900365151 1:2308980-2309002 CACCCTTTCCTGCAGCTGCCAGG + Exonic
900709101 1:4101233-4101255 CCCCCTCCCCTGCTGCTGCCTGG + Intergenic
900735064 1:4294589-4294611 ATCCCTTCCTGGCTGCTGTGTGG - Intergenic
901883154 1:12205579-12205601 CACCCTGCCCTGCTGCTGCATGG - Intronic
902731826 1:18374788-18374810 CACCTTTCCTTGCTGGTCCCCGG - Intronic
903422082 1:23225245-23225267 ACCCATCCCTTGCTGCTCCCCGG - Intergenic
904851807 1:33465239-33465261 CTTCCTTCCTTGCTGCAGCCTGG + Intergenic
905337849 1:37257689-37257711 TATCCTTCCTAGCTCCTGCCTGG - Intergenic
905825399 1:41022628-41022650 AGCCCAACCTGGCTGCTGCCCGG - Exonic
906526589 1:46496838-46496860 AGCCCTGGCTTGCTGCTCCCGGG + Intergenic
906802631 1:48750917-48750939 TACCCTCCCTTGCTGCTCCAGGG - Intronic
907541059 1:55215553-55215575 AAGCCTTCCTCGCCTCTGCCTGG - Intergenic
910093003 1:83487690-83487712 AACCATTCTGTCCTGCTGCCTGG - Intergenic
910771580 1:90836523-90836545 TACCCTTCCTCACTGGTGCCTGG + Intergenic
911690710 1:100830732-100830754 CACCCCTCCCTGCTGCTGACAGG + Intergenic
911971204 1:104440226-104440248 AATCCTTCATTGCTACTGACAGG + Intergenic
912370998 1:109173952-109173974 AACCCTTCCTTTCTGGATCCTGG + Intronic
912697012 1:111849337-111849359 AGCCCCTGCTTGCTGCTTCCCGG - Intronic
914997658 1:152559065-152559087 AAACCTTCCTTGATGATGTCTGG + Intronic
915240770 1:154519899-154519921 AACCCTGCCTGGCCTCTGCCCGG - Intronic
916963676 1:169913537-169913559 AGACCTTCCTTGCTTCTTCCTGG - Intergenic
918037810 1:180892930-180892952 GACCCTTCCTGGCTGCTGCAGGG + Intergenic
919817507 1:201450876-201450898 AGCCCTTCCTGGCTACTGGCAGG + Intergenic
920387574 1:205579733-205579755 CACCCTTCCCTCCTGCAGCCTGG + Exonic
922442155 1:225664800-225664822 CACCCTTTCTTGCTGCTCTCTGG + Intergenic
922580919 1:226697446-226697468 GGGCCTTCCTTGCTGATGCCAGG - Intronic
1063297993 10:4825961-4825983 AAACCTTCCCTGCTCCTGCGTGG + Intronic
1063383985 10:5604452-5604474 AAGCCATCCTTGGTGCTGCGTGG + Intergenic
1063958361 10:11285397-11285419 AGCCTTTCCCTGCTGCCGCCTGG - Intronic
1067179755 10:43975806-43975828 AATCCTTCCTTGCCTCTTCCTGG - Intergenic
1068378212 10:56212745-56212767 AACCCTGCCTGGCTGATACCAGG + Intergenic
1070552446 10:77501494-77501516 AACCCCTCCTTGATGCTCTCTGG + Intronic
1070811160 10:79298751-79298773 CAGCCTTTCTTACTGCTGCCTGG + Intronic
1070814266 10:79313142-79313164 AACCCTGCCTCCCTGCTTCCTGG + Exonic
1070814515 10:79314303-79314325 CGCCCTTCCCGGCTGCTGCCTGG + Exonic
1072683917 10:97526001-97526023 CCATCTTCCTTGCTGCTGCCAGG - Intronic
1072799962 10:98385866-98385888 TTCCCTTCCTTCCCGCTGCCTGG + Intronic
1074318312 10:112378669-112378691 CACCCTTGCTTGATGCTGCCAGG - Intronic
1074449450 10:113547366-113547388 AACCCTTTCTTTCAGCTGCCAGG + Intergenic
1075652434 10:124137630-124137652 ATCCTTTCCTTACTGCTCCCAGG - Intergenic
1075844047 10:125530682-125530704 AACTCTGCCCTGCTGCTGACAGG - Intergenic
1081613355 11:44576633-44576655 AATCCTGCTCTGCTGCTGCCTGG + Intronic
1081752462 11:45521569-45521591 AAACCTTCCTTGCTTCAGCCAGG - Intergenic
1083856594 11:65396168-65396190 AACCCTTCCTGCCTCCTGCCTGG - Intronic
1084564728 11:69922362-69922384 AACCCCTGCCTGCTGCAGCCTGG - Intergenic
1087191283 11:95257215-95257237 AACCCTGCCTTGCCTCTTCCTGG - Intergenic
1089387059 11:118075266-118075288 AGCCCTTCCTTACTGATGGCTGG - Intergenic
1092870622 12:12802611-12802633 AGCCTTTCCTTCGTGCTGCCTGG - Intronic
1092911222 12:13146297-13146319 AACGCTTCCTTGTTGCTGGCGGG + Intergenic
1094479582 12:30871012-30871034 TACCCCTCCTTGTTGCTGCCAGG + Intergenic
1094653538 12:32399848-32399870 AACCCCTCCTACCTGCCGCCCGG + Intronic
1096655314 12:53087011-53087033 AAGCCTTCTGTGCTGCTTCCAGG + Intergenic
1096973468 12:55685106-55685128 ACCCCATCCTGGCTGCTGACGGG - Exonic
1098204903 12:68098446-68098468 GACCCTTCCTTGCCTCTTCCTGG + Intergenic
1100883682 12:99045824-99045846 AATTCTTCCTTTCTGCTGCATGG - Intronic
1101252416 12:102949278-102949300 GACCAGTCCTTGCTGGTGCCAGG - Intronic
1101308749 12:103556951-103556973 GATCCTTCCTTGCTTCTTCCAGG - Intergenic
1101798455 12:108000101-108000123 ACCCCTTCTTTACTGGTGCCAGG - Intergenic
1101951146 12:109176149-109176171 AACCAATTCTTTCTGCTGCCTGG - Exonic
1102609522 12:114099267-114099289 CACCCTGCCTAGATGCTGCCGGG - Intergenic
1103280016 12:119749832-119749854 AATCCTTTCTTGCTGCTGGTTGG - Intronic
1104448301 12:128850524-128850546 TTTCCTTCCTTCCTGCTGCCTGG + Intergenic
1104736637 12:131139346-131139368 ACCCTCTCCTTGCTGCTGTCTGG + Exonic
1104860094 12:131919088-131919110 TACCCTCCCCTGCTGCAGCCCGG - Intronic
1106199525 13:27524634-27524656 AGCCCTGCCTTCCTGCTGCCTGG - Intergenic
1108028163 13:46200353-46200375 AACCCTTTCTCTCTGCTGCTGGG - Intronic
1111192713 13:84831581-84831603 ATCCCTTCCCTGCTCCTTCCTGG + Intergenic
1112089926 13:96072453-96072475 AACTCTTCCTTGCTGCTGGGTGG + Intergenic
1112784238 13:102934139-102934161 AACCCATCAGTGCTGCTGCTTGG - Intergenic
1113558428 13:111257100-111257122 GAGCCTTTCTTGTTGCTGCCTGG + Intronic
1114613530 14:24056737-24056759 GACCCTACCCTGGTGCTGCCTGG + Intronic
1119041969 14:71282554-71282576 AACCCTTGCTTGCTGGTCTCTGG - Intergenic
1120983292 14:90310314-90310336 ATCCCAACCTTGCTGCTGCCTGG + Intronic
1121426287 14:93854463-93854485 AACTCATTCTTGCAGCTGCCGGG - Intergenic
1121639418 14:95475303-95475325 ACCCCTTCTCTGCTTCTGCCTGG - Intronic
1121665350 14:95667684-95667706 ACCCCCTCCTTGCTCCTGTCTGG + Intergenic
1122208979 14:100162737-100162759 ACCCCACCCCTGCTGCTGCCTGG - Intergenic
1123034681 14:105467088-105467110 AATCCTTCCGTGCGCCTGCCAGG + Intronic
1123037289 14:105476680-105476702 GAGACTTCCTTGCTGCTGCTGGG + Intronic
1124029962 15:26001575-26001597 AACCCCTTCTTCCTGCTGCCTGG + Intergenic
1124111682 15:26795886-26795908 AATCCTTCCTTGCCTCTCCCTGG + Intronic
1125332213 15:38593496-38593518 TTCCCTCCCTTTCTGCTGCCAGG + Intergenic
1126681308 15:51204888-51204910 ATCCCTAACTTGCTGCTGCAGGG - Intergenic
1128919465 15:71597209-71597231 AGGCCTTCCTTGGTGCTACCCGG + Intronic
1129174532 15:73830430-73830452 ACCCCTTCCCTGATGCTTCCAGG - Intergenic
1130192222 15:81748406-81748428 CACCCTTCCCTGCTGCTGACAGG + Intergenic
1130515819 15:84625039-84625061 AGCCCTTCCTGGTTGCTTCCCGG + Intronic
1130559833 15:84949449-84949471 AATCCTGGCTTGCTGCAGCCTGG + Intergenic
1130981640 15:88815971-88815993 AATCCTTCCTTGCCCCTTCCTGG + Intronic
1131369183 15:91865571-91865593 AACCCTTCCTTGCCTCTTCATGG + Intronic
1131516043 15:93077431-93077453 ATGCCCTCCTTGCTGCTGGCAGG + Intronic
1132294834 15:100727359-100727381 CACCGTTCCTAGCTGCTTCCGGG + Intergenic
1132581583 16:687126-687148 GACCCCTCCTTCCTGCTGTCTGG - Exonic
1132844623 16:1994301-1994323 ACCCCTTCCCTTCTGGTGCCAGG + Intergenic
1133279613 16:4657645-4657667 GACCCTGCATTGCTGCAGCCTGG - Intronic
1135239801 16:20794126-20794148 ATGCCTCCCTTTCTGCTGCCAGG + Intronic
1135733526 16:24913374-24913396 AACCATTCCACGCTCCTGCCTGG - Intergenic
1135888096 16:26331681-26331703 AACACTTACTTGCTGCTGGTGGG + Intergenic
1136529296 16:30856755-30856777 AACCTTCCCTTGCTGCCGGCCGG + Intronic
1136574162 16:31113376-31113398 CACCCTGCCTTGCAGCTGGCGGG - Intergenic
1139105926 16:63826379-63826401 ACCACTTCCTTGAGGCTGCCGGG - Intergenic
1140623952 16:76769853-76769875 CACCCTTCATTGATGCTGCCTGG + Intergenic
1142211375 16:88810240-88810262 AACCCCACCTTGCTGTTACCTGG + Intronic
1144207123 17:12987282-12987304 AACTCATCCTTGCTGAGGCCGGG - Intronic
1146413476 17:32610167-32610189 ATCCCTTCCTAGGTGCTACCTGG + Intronic
1146815710 17:35940342-35940364 AACCCTTTCCTGCTCCAGCCTGG - Intronic
1147321680 17:39650348-39650370 ACCCCTTCCTTGCCTCTTCCTGG - Intronic
1148161835 17:45454545-45454567 ACGCCTTCCCTCCTGCTGCCAGG + Intronic
1148330570 17:46811603-46811625 CACCCTGTCCTGCTGCTGCCTGG - Intronic
1148361150 17:47013511-47013533 AACCCTTTCCTGCTACAGCCTGG + Intronic
1150596800 17:66613576-66613598 AATCCTTCCTTGCCTCTTCCTGG + Intronic
1151827492 17:76531305-76531327 AGCCCCTCCATCCTGCTGCCGGG + Intronic
1151846044 17:76656238-76656260 AACCCTTCCTTTCTGGGGACTGG - Intergenic
1152253109 17:79221886-79221908 CACCCTTCCCCGCTCCTGCCAGG - Intronic
1153840403 18:9002391-9002413 AACCCTTCCTTGCCCCTTCTAGG - Intergenic
1153998774 18:10465222-10465244 CACCCCTCATGGCTGCTGCCTGG - Intronic
1155063978 18:22253286-22253308 CATCCTTCCTTGCTCCTGGCAGG - Intergenic
1155400426 18:25432897-25432919 CACTTCTCCTTGCTGCTGCCAGG + Intergenic
1156345540 18:36253721-36253743 AGCCCTGCCATGCTGCTCCCTGG - Intronic
1156524131 18:37750393-37750415 GAGCCTTCTTTGCTGTTGCCAGG - Intergenic
1157608081 18:48938880-48938902 AACAGGTCCTTGCTGCTGCTTGG - Intronic
1158963387 18:62604279-62604301 GTTCCTTCCTTGCTGCTCCCAGG - Intergenic
1158973319 18:62688328-62688350 AATCCTTCCTTGCCTCTTCCTGG + Intergenic
1159014903 18:63093359-63093381 AACCTTTCCTTGCCTCTTCCTGG + Intergenic
1159793715 18:72816601-72816623 AAATTCTCCTTGCTGCTGCCTGG - Intronic
1160823221 19:1067735-1067757 CACCCTCCCTTCCTGCTCCCTGG - Intronic
1161400339 19:4064466-4064488 AGCCCAGCCCTGCTGCTGCCAGG - Intronic
1162148439 19:8628251-8628273 GACCCTTCCTTGCTTCTCCCTGG + Intergenic
1162981557 19:14243609-14243631 ACTCCTTCCTTGCCCCTGCCTGG + Intergenic
1163476451 19:17528818-17528840 CACTCTTCCATGCTGCTGCATGG - Intronic
1165502663 19:36202515-36202537 ATCCCTCCCTTGGTGGTGCCTGG - Intronic
1166158738 19:40935938-40935960 AACCCTTACTTGCTGGATCCTGG + Intergenic
1166941999 19:46372989-46373011 AGCACTTGCCTGCTGCTGCCTGG + Intronic
1167211507 19:48136705-48136727 AACCCTGGCTTCCTGCTGCAGGG + Intronic
1167356039 19:49004712-49004734 ACTCCTTTCTTCCTGCTGCCTGG - Intronic
925001649 2:407704-407726 AGCCCTTCCTTGCTGCTCACAGG - Intergenic
926432792 2:12806650-12806672 AACCCTTCCACGCTGATTCCTGG + Intergenic
927744132 2:25600355-25600377 AACTCTTTCTTCCTTCTGCCTGG + Intronic
928124618 2:28606941-28606963 AAGCCTGCCTGGCTCCTGCCTGG - Intronic
928564625 2:32532351-32532373 ACTCCTTCCTTGCTTCTTCCTGG + Intronic
929947906 2:46384198-46384220 AGCCTTTCCTCCCTGCTGCCAGG + Intronic
931101484 2:59006507-59006529 GACCCTCCCTTGGTCCTGCCAGG - Intergenic
931606260 2:64055740-64055762 AACCCTCATGTGCTGCTGCCGGG - Intergenic
932123025 2:69118741-69118763 AAGCCTTCCTTGCTGCACCTCGG - Intronic
932410600 2:71545072-71545094 AAGCCTTCCTTGATTCTGTCAGG - Intronic
932626595 2:73301251-73301273 GGCCCTGACTTGCTGCTGCCTGG - Intergenic
934718927 2:96559423-96559445 AATCCTTCCTTGCCTCTTCCTGG - Intergenic
935173608 2:100629285-100629307 AACTCTACTTTGATGCTGCCGGG + Intergenic
936450725 2:112632129-112632151 ATCTCTTCCTTGTTGTTGCCTGG + Intergenic
936929684 2:117774683-117774705 AACCATGCCTCACTGCTGCCTGG - Intergenic
936969311 2:118161610-118161632 AAATCTTCATTGATGCTGCCAGG - Intergenic
937325028 2:120985262-120985284 AGCCGGTCCATGCTGCTGCCTGG + Intronic
938083362 2:128382038-128382060 AACAGTTCCTTGATGCTGACCGG + Intergenic
940062520 2:149587983-149588005 AAGCCTTCCTTACTGCCTCCAGG + Intergenic
940122412 2:150281494-150281516 AAACATTCCTTGCTCTTGCCTGG - Intergenic
941083430 2:161088942-161088964 AGCCATGCCTTGATGCTGCCAGG - Intergenic
946228864 2:218279446-218279468 AACCCTCCCTAGCTGCAGCCTGG + Intronic
946337079 2:219045031-219045053 AAGCATTCCTTTCTGCTGCCTGG + Intergenic
946870305 2:224078779-224078801 AACCCTTCCTCGCCTGTGCCAGG + Intergenic
948598572 2:239095845-239095867 TACCATTCCTAGCGGCTGCCTGG + Intronic
948632276 2:239309888-239309910 CCCCCTCCCATGCTGCTGCCTGG + Intronic
948868876 2:240788445-240788467 AACCCGTCCTGCCTCCTGCCTGG - Intronic
948910971 2:241002496-241002518 ATGCCCTTCTTGCTGCTGCCTGG + Intronic
1168935020 20:1657598-1657620 AACCCTTTCTCCCTGCTTCCTGG - Intronic
1170073391 20:12392856-12392878 AATCCTTCCTTGCCTCTTCCTGG - Intergenic
1172006240 20:31820478-31820500 AGCCCCTCCTGGCTGCTGCTTGG - Exonic
1175117100 20:56690330-56690352 AACACTTCCTGGGTGCTTCCTGG - Intergenic
1175147643 20:56909026-56909048 AAGCCTTCCTGGCTCCTCCCTGG - Intergenic
1175353479 20:58343492-58343514 AACCCTTCCTTCTTGGTGTCGGG + Intronic
1175403876 20:58714999-58715021 GAGCCTTCCATGCTGCTGGCTGG - Intronic
1175945447 20:62556471-62556493 TTCCCGTCCTGGCTGCTGCCCGG - Intronic
1178450440 21:32693659-32693681 AACCCTTACATGGTGCTGACTGG + Intronic
1178887046 21:36492808-36492830 GCCCCTTCCTTGCTGGTCCCAGG - Intronic
1179190773 21:39119961-39119983 TGCTCTTCCTTCCTGCTGCCTGG - Intergenic
1179611272 21:42552870-42552892 AACCCATCTCTGCTTCTGCCTGG + Intronic
1181038357 22:20180439-20180461 AGCCCGGCCTGGCTGCTGCCAGG + Intergenic
1181481594 22:23203252-23203274 GACCCTTGATGGCTGCTGCCAGG + Intronic
1182111244 22:27725250-27725272 AGCCCTTCCCAGCTGCTGGCTGG + Intergenic
1182140433 22:27951856-27951878 AACCCTTGCATACTGCTGGCAGG - Intergenic
1184205251 22:42998268-42998290 GAACCTTCTTTGCTGCTGCAGGG + Intronic
1184272908 22:43395045-43395067 ACCACCTGCTTGCTGCTGCCTGG + Intergenic
1184330910 22:43826894-43826916 AGCCCTCCCTTGTGGCTGCCAGG - Intronic
1184461749 22:44641638-44641660 AGCCCTTTCTTGCTGCTCTCTGG - Intergenic
1184616401 22:45641085-45641107 AACCCAGCCTGGCTGCTCCCTGG - Intergenic
949479280 3:4477953-4477975 AGGCCATCCTTGCTGCTTCCAGG + Intergenic
951041217 3:17990643-17990665 AATGCTTCCTTTCTGCTTCCAGG + Intronic
951795974 3:26538765-26538787 AACCCTTCCCTGCTTTTGGCTGG + Intergenic
952991063 3:38831245-38831267 ATCTCTTCCTTCTTGCTGCCTGG - Intergenic
953451294 3:43008629-43008651 AGCCCTGCTTTCCTGCTGCCAGG + Intronic
954616204 3:51969892-51969914 CACCCTTCCTTGCTCCTGGCAGG + Intronic
954913143 3:54125459-54125481 TATCATTTCTTGCTGCTGCCTGG + Intronic
955142940 3:56287699-56287721 AACCACTTCTTGATGCTGCCAGG - Intronic
955344092 3:58148376-58148398 TACCCTTCCTGGCTGGAGCCAGG + Intronic
957350823 3:79019788-79019810 ACCTCTTCCTTGCCGCTTCCAGG + Intronic
957963625 3:87293307-87293329 TACCCTTCCTGGATGCAGCCAGG - Intergenic
959356642 3:105339176-105339198 AACCCTTCCCTGTAGATGCCAGG + Intergenic
961433965 3:126903631-126903653 AGCCCTGCCTTGGTGCTGCTGGG - Intronic
962198404 3:133381946-133381968 AGCTTCTCCTTGCTGCTGCCTGG + Intronic
963043447 3:141085495-141085517 AGCTCTTCCATTCTGCTGCCTGG - Intronic
963310184 3:143700808-143700830 ACCACTCCCTGGCTGCTGCCAGG - Intronic
964384627 3:156134324-156134346 AAGCTTTTCTTGCTGCTGTCAGG + Intronic
967229683 3:187325642-187325664 ATCCGTTCCATGCTGCTCCCTGG + Intergenic
969359163 4:6650737-6650759 AATCTTTCCTTGCTTCTCCCTGG + Intergenic
969439432 4:7208535-7208557 ATCCCTTGCCTGCGGCTGCCGGG - Intronic
974098722 4:57393903-57393925 AGTCCTTCCCTGCTGCTGCTGGG + Intergenic
974198325 4:58605631-58605653 AACCCTTACATGCTGTTGGCGGG - Intergenic
976260316 4:83139158-83139180 AACCCTGTCATTCTGCTGCCAGG - Intergenic
977024096 4:91793459-91793481 GTCCTTTACTTGCTGCTGCCAGG - Intergenic
977987892 4:103406225-103406247 AATCGTTCCTTGCTTCTTCCTGG + Intergenic
985886454 5:2683905-2683927 CAGCCCTCCCTGCTGCTGCCAGG + Intergenic
986644869 5:9907128-9907150 TCTCCTTCCTTGCTGCTTCCTGG + Intergenic
986797476 5:11226031-11226053 AATCCTTCCTTGCCTCTGCCTGG - Intronic
989581736 5:43039850-43039872 AGCCCTTGCTGGCGGCTGCCCGG - Exonic
990610977 5:57456616-57456638 TTCCCTTGCTTGCAGCTGCCAGG + Intergenic
990957207 5:61354090-61354112 GACCATTCCTGGATGCTGCCTGG - Intronic
991031323 5:62085228-62085250 AACCCTTCCTTGTGGCACCCAGG - Intergenic
991770684 5:70038067-70038089 AACACTTCCTTGCAGCAGTCTGG + Intronic
991849978 5:70913485-70913507 AACACTTCCTTGCAGCAGTCTGG + Intronic
996154394 5:120080048-120080070 GACTCTTCCTTCCTGCTGGCAGG - Intergenic
997510490 5:134450490-134450512 AACCCTTCCTTGACTCTGCTTGG - Intergenic
998937215 5:147241943-147241965 AACTCTTCCTTGATTCAGCCAGG + Intronic
999823236 5:155249363-155249385 ACCCCTCCCTTCCTGCTTCCAGG - Intergenic
999861453 5:155651557-155651579 AACCCTTATTTGCTGCTGGTGGG + Intergenic
1001154777 5:169263463-169263485 GGCCCTTCCTTGCTCCTTCCTGG - Intronic
1001515223 5:172350678-172350700 AACCCGTCGTTCCTGCTCCCTGG - Intronic
1005482173 6:26265294-26265316 AAACCTGCTTTGGTGCTGCCAGG - Intergenic
1006451672 6:34109119-34109141 AACCCTTCCTTGCTGCTGCCTGG + Intronic
1007396979 6:41583499-41583521 AACCTTCCCTTCCTGCTTCCGGG + Intronic
1007994146 6:46288355-46288377 ACACCTTACTTGCTGGTGCCTGG - Intronic
1012931481 6:105321932-105321954 AACACTTGCTGGGTGCTGCCTGG + Intronic
1015503036 6:133953039-133953061 CACCCTTCCTTCCTCCTTCCTGG - Intronic
1016004651 6:139077146-139077168 AACCCTTCCTTGCCTCTTCCTGG - Intergenic
1016730287 6:147421119-147421141 ACACCTTCCCTGCTTCTGCCTGG + Intergenic
1016933259 6:149429342-149429364 AGCCCTTTCTTCCTACTGCCAGG - Intergenic
1017616138 6:156248751-156248773 AACCCTTTATAGATGCTGCCTGG + Intergenic
1017772059 6:157651236-157651258 AACCCTTCCTTGCCTCTTCCTGG + Intronic
1019597604 7:1865389-1865411 ATCCCAGCCCTGCTGCTGCCCGG + Intronic
1021000860 7:15328606-15328628 AACCCTTAATGGCTGCTTCCGGG - Intronic
1023170307 7:37385088-37385110 AACCTCTCCTAGCTGCTCCCTGG + Intronic
1023291813 7:38675950-38675972 AATTCTGCCTTGCTGGTGCCTGG - Intergenic
1023725548 7:43139432-43139454 AACTATTCCTTTGTGCTGCCAGG + Intronic
1024513690 7:50224351-50224373 AACCCTTACATGCTGTTGGCAGG + Intergenic
1024835463 7:53513087-53513109 AATCCTTCCTTGCCTCTTCCAGG - Intergenic
1024959158 7:54957011-54957033 AACCATTGTTGGCTGCTGCCTGG - Intergenic
1026023491 7:66728137-66728159 AATCCTTCCTGGCTGTGGCCAGG + Intronic
1027309862 7:76944185-76944207 AACCATTCTGTCCTGCTGCCTGG - Intergenic
1029572068 7:101376590-101376612 AGCCCACCCTTGCTGCTGCAGGG + Intronic
1032246684 7:130219327-130219349 AACCTTTCTCTGCTGCAGCCTGG + Intergenic
1032267707 7:130380509-130380531 AACCCCCGCATGCTGCTGCCGGG - Exonic
1034875390 7:154720596-154720618 ACCCCTGCCATGCTGCAGCCGGG - Intronic
1034877859 7:154741316-154741338 CACCCTTCCTGGGTTCTGCCAGG - Intronic
1034987677 7:155527276-155527298 AAACCTGCATAGCTGCTGCCTGG + Intronic
1035169884 7:157011219-157011241 AACCCTCCCCTGCTGCGCCCTGG - Intergenic
1037876659 8:22551948-22551970 ATCCCTGCCCGGCTGCTGCCTGG - Exonic
1037893760 8:22638073-22638095 AAGTCTTCCTGGCTGCTCCCTGG + Intronic
1038004645 8:23419287-23419309 AATCCTTCCTTGCCCCTTCCTGG - Intronic
1039484223 8:37898959-37898981 AGGCCTTCCCCGCTGCTGCCCGG + Intronic
1039666698 8:39541125-39541147 AACCCTTATATGCTGCTGCTTGG - Intergenic
1040840486 8:51779572-51779594 CATCCTTTCTTTCTGCTGCCTGG - Intronic
1047302080 8:123622204-123622226 AACCCTTCCATGTCACTGCCAGG + Intergenic
1048007194 8:130428975-130428997 AATCCTTCCTTGCCTCTTCCTGG + Intronic
1048180865 8:132193114-132193136 AACCCTTGCTTACTCCTGCAGGG - Intronic
1048308801 8:133302412-133302434 AATCCTTCCTTGCCCCTTCCTGG + Intergenic
1048955397 8:139531888-139531910 ATCCATTTCTTGCTGCTGTCAGG - Intergenic
1051020810 9:12540261-12540283 ATCCATTCCTTGCTTCTGACTGG + Intergenic
1051949112 9:22609420-22609442 AACTCTTCCTTGCTGTTGTTGGG + Intergenic
1052874288 9:33541977-33541999 CTCCCTCTCTTGCTGCTGCCTGG + Intronic
1058323924 9:103671750-103671772 AATGCTTCCTTGTTGCTTCCTGG - Intergenic
1058537117 9:105973215-105973237 AACCCTTCTTTGCCTCTGCGAGG + Intergenic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1062052348 9:134454163-134454185 AACACTGCCTCCCTGCTGCCCGG + Intergenic
1062093025 9:134688527-134688549 AAGCCTTCTTTGCTGGGGCCAGG + Intronic
1185924962 X:4135587-4135609 AACCTTTCCTTACCTCTGCCTGG + Intergenic
1192410789 X:70930728-70930750 AACCCTTCCTCTCTGCTGAGAGG - Intronic
1195175464 X:102311144-102311166 ATCCCTTCCTTGCTGATCCTGGG - Intronic
1195183400 X:102375949-102375971 ATCCCTTCCTTGCTGATCCTGGG + Intronic
1196111264 X:111949725-111949747 AACACTTCTATGCTGCTGCTGGG + Intronic
1197059062 X:122154818-122154840 CACTGCTCCTTGCTGCTGCCTGG + Intergenic
1200270721 X:154680120-154680142 AGCCCTTCCTACCTGCTGCATGG + Exonic
1201242426 Y:11971804-11971826 ATCACATCCTTACTGCTGCCTGG + Intergenic