ID: 1006452180

View in Genome Browser
Species Human (GRCh38)
Location 6:34111669-34111691
Sequence CAAGAGCTGATGGGCTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 12, 3: 37, 4: 296}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006452165_1006452180 20 Left 1006452165 6:34111626-34111648 CCCATGGGAGAACCAGCCTGGCA 0: 1
1: 0
2: 2
3: 17
4: 127
Right 1006452180 6:34111669-34111691 CAAGAGCTGATGGGCTGGGTGGG 0: 1
1: 0
2: 12
3: 37
4: 296
1006452166_1006452180 19 Left 1006452166 6:34111627-34111649 CCATGGGAGAACCAGCCTGGCAG 0: 1
1: 0
2: 2
3: 24
4: 279
Right 1006452180 6:34111669-34111691 CAAGAGCTGATGGGCTGGGTGGG 0: 1
1: 0
2: 12
3: 37
4: 296
1006452171_1006452180 4 Left 1006452171 6:34111642-34111664 CCTGGCAGGGGCAAAGCTCAAGG 0: 1
1: 0
2: 3
3: 28
4: 209
Right 1006452180 6:34111669-34111691 CAAGAGCTGATGGGCTGGGTGGG 0: 1
1: 0
2: 12
3: 37
4: 296
1006452163_1006452180 24 Left 1006452163 6:34111622-34111644 CCTGCCCATGGGAGAACCAGCCT 0: 1
1: 0
2: 1
3: 18
4: 203
Right 1006452180 6:34111669-34111691 CAAGAGCTGATGGGCTGGGTGGG 0: 1
1: 0
2: 12
3: 37
4: 296
1006452170_1006452180 8 Left 1006452170 6:34111638-34111660 CCAGCCTGGCAGGGGCAAAGCTC 0: 1
1: 0
2: 2
3: 25
4: 240
Right 1006452180 6:34111669-34111691 CAAGAGCTGATGGGCTGGGTGGG 0: 1
1: 0
2: 12
3: 37
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006452180 Original CRISPR CAAGAGCTGATGGGCTGGGT GGG Intronic
900558425 1:3291568-3291590 CAAGAGGGGATGGGCAGGGGCGG - Intronic
901055919 1:6448556-6448578 CAGGAGGTGAAGAGCTGGGTGGG + Intronic
902478475 1:16700083-16700105 CAGGAGGTGAAGAGCTGGGTGGG - Intergenic
903335849 1:22623968-22623990 CAGTGGGTGATGGGCTGGGTGGG + Intergenic
903565098 1:24259194-24259216 CGAGGGCTGCTTGGCTGGGTGGG + Intergenic
903574654 1:24331698-24331720 CCAGAGATGAGGGGCTGGGGTGG - Intronic
905358871 1:37404629-37404651 AAAGAGCTGGTGGACTGGGAGGG - Intergenic
905609826 1:39340846-39340868 CAAGATCTGAGAGCCTGGGTTGG + Intronic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
906291114 1:44619723-44619745 GCAGAGCTGATGGGCTGGGCGGG + Intronic
907520797 1:55022180-55022202 CAGCAGCTTATGGGCTGGGCCGG + Intergenic
908802609 1:67896235-67896257 CCAGAGCTAATGGGATAGGTTGG + Intergenic
911088504 1:93999426-93999448 TAAGGGCTGATGGGCCAGGTGGG + Intronic
911828755 1:102523499-102523521 CCAGTGGTGGTGGGCTGGGTAGG - Intergenic
912346698 1:108969543-108969565 GGAGTGCTGATGGGTTGGGTTGG - Intergenic
912410171 1:109475723-109475745 TGAGAGATGATGTGCTGGGTTGG - Intronic
913473157 1:119210539-119210561 CCACAGCTGATGGGCAGTGTTGG + Intergenic
913608828 1:120491383-120491405 CAGGAGCTGACGGGGTGGGAGGG + Intergenic
914205000 1:145519068-145519090 CAGGAGCTGATGGGGTGGGAGGG - Intergenic
914235660 1:145808974-145808996 AAACAGCTGATGGGCTTTGTAGG - Intronic
914484119 1:148092250-148092272 CAGGAGCTGATGGGGTGGGAGGG - Intergenic
914582368 1:149030455-149030477 CAGGAGCTGACGGGGTGGGAGGG - Intronic
914916462 1:151822294-151822316 CAGGAGCGGGAGGGCTGGGTGGG + Intronic
915287091 1:154860063-154860085 CAAGAGCAGCTGGGCAGGGGAGG - Intronic
916061173 1:161099417-161099439 CAATAGCTGATGACCTGGATGGG - Exonic
916211890 1:162366494-162366516 AAAGAGCTCATGGGATGGTTTGG - Intronic
916313758 1:163425352-163425374 CAAGTGCTGATAGGCTTGGCTGG - Intergenic
917222376 1:172745644-172745666 CAAGAGTTAAGGGGCTGGGGAGG - Intergenic
917519455 1:175736009-175736031 CAAGTGCTAATGGGTTGGGTTGG - Intronic
918120110 1:181530828-181530850 CAGGAGCTGCTGGGCTGGAGAGG + Intronic
918452543 1:184673486-184673508 GGAGTGCTGATTGGCTGGGTTGG - Intergenic
919098433 1:193064114-193064136 CAAAAACTGATGTGCTGGGAAGG - Intronic
919600643 1:199618184-199618206 CCAGTGGTGATGGGCTGGGCAGG - Intergenic
919794576 1:201313562-201313584 TGAGTGCTGCTGGGCTGGGTTGG + Intronic
920179933 1:204126310-204126332 GAGGAGCTGTTGGCCTGGGTGGG + Exonic
920376603 1:205512132-205512154 CTGGAGCTGAGGGGCTTGGTGGG + Intronic
920847840 1:209608416-209608438 GAAGAGGTGATGGGCAGGTTAGG - Intronic
920950126 1:210564795-210564817 CAAAAGCTGATGGAATGGGGAGG + Intronic
921218757 1:212958479-212958501 CAAGAGCTGGATGGCAGGGTGGG - Intronic
924475795 1:244380985-244381007 CGGGAGCTGAGGGGCTGGGGAGG + Intronic
1064144377 10:12815821-12815843 CAGGACCTGATGGGCTGAGCAGG + Intronic
1065427216 10:25618295-25618317 GAAATGCTGATTGGCTGGGTTGG + Intergenic
1066129505 10:32378791-32378813 CGAGCGCTGATTGGCTGGGAGGG + Intronic
1069196715 10:65560157-65560179 GAAGTGCTGATTGGTTGGGTTGG + Intergenic
1069212642 10:65780276-65780298 CAGGGGCTGCTGGGCTGAGTGGG + Intergenic
1069662263 10:70131697-70131719 CCAGAAGTGATGGGCTGGGCAGG - Intronic
1069884682 10:71616231-71616253 CAACGGCTGATGGCCTGGGCTGG - Intronic
1069907884 10:71742522-71742544 TAGGAGCTGATGAGCTGTGTTGG + Intronic
1072873323 10:99144666-99144688 CAAGTCCTGAAGGGCTGGGAAGG - Intronic
1073208708 10:101781963-101781985 CCAGTGCTTATGGGCTAGGTGGG + Intronic
1076347530 10:129789909-129789931 CAAAAGCTGTTGGTGTGGGTGGG + Intergenic
1076694894 10:132242673-132242695 CAAGGGCTGATGTGCAGGCTGGG - Intronic
1077355841 11:2116520-2116542 CAACAACTGAGGGGCTGGGATGG + Intergenic
1077575806 11:3382522-3382544 CAAGAGATGTTGTGCTGGGGAGG + Intergenic
1077913465 11:6594679-6594701 GAAGAGCTGAAGGGCAGTGTGGG + Intergenic
1078675408 11:13408022-13408044 GAAGAATTGATGGGCTGGGGTGG - Intronic
1082269564 11:50155268-50155290 CAGGAGCTGAGGGGATGGGGAGG - Intergenic
1083194793 11:61079426-61079448 CAAGAACTGAGGGGCAGGGTGGG + Intergenic
1083892716 11:65604712-65604734 GAAGAGGCGATGGGCTGGGTGGG + Intronic
1084163832 11:67365902-67365924 GACGTGCTGATTGGCTGGGTGGG + Intronic
1084171197 11:67401793-67401815 CAGGAGCTGCTGGGCTGGAGCGG - Exonic
1084292141 11:68179607-68179629 CAAGAGCTGACTGGAGGGGTGGG + Intronic
1084758918 11:71256119-71256141 GAAGAGCTCATGGCCTGGCTGGG - Intergenic
1085907423 11:80780901-80780923 CAAGATCAGTTAGGCTGGGTAGG - Intergenic
1089036320 11:115396734-115396756 AAGGAGATGATGGGCTGGGAAGG + Intronic
1089459098 11:118642299-118642321 CAGGAGCTGATGGCCGGGCTGGG + Exonic
1089555138 11:119312008-119312030 AAGGGGCTGATGGGGTGGGTGGG - Intronic
1089858993 11:121572289-121572311 ACAGAGCTCAGGGGCTGGGTGGG - Intronic
1091445917 12:544059-544081 CCAGAGCTGAGGAGCTGGGGCGG + Intronic
1091491651 12:937719-937741 TAAGAGCTGAAGGGATGGCTGGG - Intronic
1091823214 12:3491502-3491524 CTCCAGCTGAGGGGCTGGGTTGG + Exonic
1092210360 12:6642073-6642095 AGAGAGCAGATGGGGTGGGTTGG - Intronic
1092350268 12:7750496-7750518 AATAAGCTGGTGGGCTGGGTGGG + Intronic
1092913536 12:13169143-13169165 CAAGAGCTAATAGGGTGGGGTGG + Intergenic
1094498747 12:31005508-31005530 CCAGAGATGATGGGGTGGGCTGG - Intergenic
1096235803 12:49925669-49925691 CAAGAGAGGAAGGGCTGGGTAGG - Intergenic
1096692333 12:53328794-53328816 CAAGAGGTGGGGAGCTGGGTAGG + Exonic
1097785489 12:63754254-63754276 GAAGAGCTGATGTGCTTGCTTGG + Intergenic
1097893191 12:64799155-64799177 GGAGAGCTGATGGGATGGGAGGG + Intronic
1101017736 12:100519363-100519385 CCACAGCTGTGGGGCTGGGTGGG + Intronic
1101321969 12:103680621-103680643 CAAGGGCTGATGGGAGTGGTAGG - Intronic
1101392873 12:104318473-104318495 AAAAAGCTGATGGGCTGGATTGG + Intronic
1101871752 12:108571469-108571491 CATCACCTGATGGGCTGGGTGGG + Intergenic
1101894456 12:108745539-108745561 TGAAAGCTGATGGGCAGGGTGGG + Intergenic
1102554400 12:113717400-113717422 CAAGAGTTGATGGGCTCAGCTGG - Intergenic
1102962985 12:117105689-117105711 CAAGAGTTGAAGGTCTGGGTGGG - Intergenic
1103036083 12:117657663-117657685 CCAGAGCTGCAGGGCTGGCTGGG - Intronic
1104641037 12:130467466-130467488 GGAGTGCTGATTGGCTGGGTTGG - Intronic
1105210808 13:18255704-18255726 CAAGAGATGATGGCCTGGGTGGG + Intergenic
1105304273 13:19158111-19158133 CGAGTGCTGGTGGGCTGGGATGG - Intergenic
1105742997 13:23348421-23348443 CTTCAGCTGCTGGGCTGGGTGGG - Intronic
1109601889 13:64642398-64642420 CGAGTGCTGATTGGCTGGGTCGG + Intergenic
1110339299 13:74370303-74370325 GAAGGGCCGAGGGGCTGGGTGGG - Intergenic
1110928409 13:81184900-81184922 CAGGAACTGATGGGTGGGGTGGG - Intergenic
1111462711 13:88567252-88567274 CAAAAGCACATGGGCTGTGTGGG + Intergenic
1111907186 13:94268959-94268981 CAGGGGCTCATGGGCTGGGAGGG + Intronic
1116315140 14:43376463-43376485 CAGGAGTTGAGGGGCTGGGAGGG + Intergenic
1117325356 14:54663872-54663894 ACTGAGCTGATGGGATGGGTGGG - Intronic
1120352600 14:83381974-83381996 GAAGAGATGATGGGCAGGGAAGG + Intergenic
1121005733 14:90489538-90489560 CAAGCCCTGAGGGGCTGGGGAGG + Intergenic
1121227046 14:92328718-92328740 GAAGTTCTGTTGGGCTGGGTTGG + Intronic
1121630749 14:95420267-95420289 CCATAGCTGCTGGGTTGGGTGGG + Intronic
1122111205 14:99504050-99504072 CAAGGGCAGCTGGGCTGGGCCGG - Exonic
1122116024 14:99527693-99527715 CCAGGGCTGCTGAGCTGGGTGGG - Intronic
1122556491 14:102583532-102583554 CAAGAGGTCCTGGGCGGGGTGGG + Intergenic
1122770531 14:104095752-104095774 CAGGAGCTGCTGGGCTGAGCAGG - Intronic
1126755074 15:51917881-51917903 CAGGAGCTGGGGGACTGGGTTGG - Intronic
1129295005 15:74595428-74595450 GAAGTGCTGATGGGCTGGGGAGG - Intronic
1129381155 15:75167931-75167953 CGAGTGCTGATTGGTTGGGTGGG + Intergenic
1129539070 15:76336617-76336639 CAGGGGCTGATGGGCGGGGTGGG - Intergenic
1130371386 15:83287677-83287699 CAAATGCTGAGGGGCTGGGCAGG + Intergenic
1132436932 15:101814248-101814270 TAATAGCTGAAGGGCTGGGTAGG - Intronic
1132587138 16:710493-710515 TCAGGGCAGATGGGCTGGGTGGG + Intronic
1133192197 16:4142392-4142414 CAAGGGCAGAGGGGATGGGTGGG - Intergenic
1134173634 16:11988766-11988788 CAAGAACTGGTGAACTGGGTTGG + Intronic
1137247112 16:46714735-46714757 CAAGCTCTGATGGCCTAGGTTGG - Intronic
1137683635 16:50371408-50371430 CAAGAGCTGTTGGGCTGTTGGGG - Intergenic
1137874600 16:51984143-51984165 CAGGAGCTGATGGGGTTGGCAGG - Intergenic
1138858435 16:60724244-60724266 CAAGAGCAGATGGAGGGGGTTGG + Intergenic
1139504386 16:67391823-67391845 CCAGTGCTGAGGGGCTGGGCTGG + Exonic
1140929899 16:79617960-79617982 CAAGCTCTGATGGGGTTGGTAGG + Intergenic
1142324617 16:89406576-89406598 CCAGTGCTTATGGTCTGGGTGGG + Intronic
1142555002 17:769312-769334 CAAGAGCTGAGGGGATGGGATGG + Intronic
1142556420 17:781376-781398 TTAGAGCTCATGGCCTGGGTTGG - Intronic
1143278945 17:5736115-5736137 CAAGAGCCCATGTGCTGGGCTGG - Intergenic
1144686377 17:17228734-17228756 CAAGAGTTGAAGGGCAGGGTGGG + Intronic
1144759562 17:17699778-17699800 GACCAGCTGGTGGGCTGGGTGGG - Intronic
1144789284 17:17848423-17848445 CCTCAGCTGATGGGCTGGATGGG - Intronic
1145312772 17:21709407-21709429 CAAGGGCTGATATTCTGGGTTGG - Intergenic
1145888539 17:28398936-28398958 CAGAAGCTGCTGGGCTGGGCAGG - Exonic
1146702602 17:34974314-34974336 CAAGAGCTGATTTTATGGGTTGG - Intronic
1148460992 17:47838899-47838921 CAAGGGCTGGTGGGATGGGCAGG - Exonic
1148528082 17:48361887-48361909 CAGAAGCTGGTGGGATGGGTAGG - Intronic
1148871705 17:50662285-50662307 GCTGAGCTGATGGGCTCGGTGGG + Intronic
1149666982 17:58371749-58371771 TTAGAGCAGATGGGCTGGGCTGG - Intronic
1150608412 17:66713894-66713916 TCAGAGCTGATGGTTTGGGTGGG + Intronic
1151566714 17:74902585-74902607 GAAGAACTGATGGGATGGGGTGG - Intergenic
1152664169 17:81557807-81557829 CAAGAGCAGATGAGCTGCTTGGG + Exonic
1154207910 18:12353931-12353953 GATGAGCTGATGGGCTTGGATGG - Intronic
1154467863 18:14667313-14667335 CACCTACTGATGGGCTGGGTTGG + Intergenic
1156863525 18:41865072-41865094 CAAGAGCTGAGGGGATGCGGGGG - Intergenic
1157697227 18:49732599-49732621 CAGGGGCTGCAGGGCTGGGTGGG - Intergenic
1158392402 18:57054015-57054037 CAGGAGATGAGGGGGTGGGTGGG + Intergenic
1158573665 18:58617881-58617903 CAAGAGCAGATGGGTTAAGTGGG - Intronic
1160797592 19:953079-953101 CCAGAGCCGGTGGGCTGGGGAGG + Intronic
1160859889 19:1233323-1233345 CAGGAGGTTGTGGGCTGGGTGGG - Intronic
1161237180 19:3203971-3203993 CGAGAGCTGGCGGGGTGGGTGGG - Intronic
1161849544 19:6731394-6731416 CAGCAGCTGAGGGGCTGGGGTGG + Intronic
1162988647 19:14288224-14288246 CAAGATCTCATGGCCTGGGGAGG + Intergenic
1163299665 19:16436133-16436155 GGAGAGGTCATGGGCTGGGTGGG - Intronic
1165116554 19:33532621-33532643 GCAGTGGTGATGGGCTGGGTGGG - Intergenic
1165330353 19:35138527-35138549 CAAGAGCTTTTGGGCTGAGGCGG - Intronic
1165804485 19:38572297-38572319 CAAGGGCTTATTGGCTGGGTGGG + Intronic
1166585058 19:43938186-43938208 CAAGAGTTGTGGGTCTGGGTGGG + Intergenic
1166599782 19:44083803-44083825 GTAGTGGTGATGGGCTGGGTGGG + Intronic
1167929954 19:52855972-52855994 GAAGGGCTAATGGGATGGGTTGG + Intronic
1167946022 19:52989686-52989708 AAAGAGCTAATGGGAAGGGTTGG + Intergenic
1168305312 19:55432111-55432133 CCAGAGATGATGGTCTGTGTAGG - Exonic
1202712494 1_KI270714v1_random:25914-25936 CAGGAGGTGAAGAGCTGGGTGGG - Intergenic
925112607 2:1349118-1349140 GAACTGCTGATTGGCTGGGTTGG + Intronic
925645246 2:6029309-6029331 CAAAAGCCCATGAGCTGGGTGGG - Intergenic
927698656 2:25253507-25253529 CAAGAGCTGCCGGGCTGGGGAGG + Intronic
929599892 2:43198428-43198450 TGAGAGCTGATGTGCAGGGTAGG - Intergenic
931440568 2:62287463-62287485 AAAGAGCTGGTGGGATGGCTTGG - Intergenic
932575028 2:72958099-72958121 CCAGAGCTGGAGGCCTGGGTGGG + Intronic
935074928 2:99732037-99732059 CAATAGCTGGTGGGAAGGGTGGG - Intronic
937926423 2:127171068-127171090 CAAGAGGAAATGAGCTGGGTAGG + Intergenic
938695708 2:133833570-133833592 AAAGAGCTAATGGCCTGGGTGGG + Intergenic
939283590 2:140099046-140099068 GAAGAGCTGATGAGGTAGGTTGG + Intergenic
940491147 2:154362573-154362595 CAAGAGCTTTTGGGTTGGGTGGG - Intronic
944093390 2:195939703-195939725 CTAGAGCTGATGAGATTGGTGGG - Intronic
944119234 2:196223156-196223178 CAGGAGCTAATGGGCTAGTTGGG + Intronic
945960755 2:216132374-216132396 CAAGAGATGATGAGGTGAGTTGG + Exonic
946414585 2:219533476-219533498 CAGGAGTTGACGGGCTGTGTGGG - Intronic
946884635 2:224210722-224210744 CAAGAGGTCATGGGCGGGGTAGG + Intergenic
947868533 2:233418834-233418856 GCAGAGCTGGTGGGCTGGGCGGG + Intronic
948283354 2:236765699-236765721 CCAGAGCTGGGGGGCAGGGTGGG - Intergenic
948921759 2:241069177-241069199 CAGGAGCCGCTGGGCTGGGCTGG + Intronic
949010699 2:241676769-241676791 CTCGACCTGGTGGGCTGGGTGGG - Intronic
1168954462 20:1825176-1825198 CAGGAGCTGTTGGGCAGTGTTGG - Intergenic
1169854542 20:10088952-10088974 AAAGTGCTGATTGGTTGGGTTGG - Intergenic
1171029960 20:21668627-21668649 TCAGAGCTGGTGGGTTGGGTGGG + Intergenic
1171291948 20:23987393-23987415 CAAGAGATGATGGCCTGGGTGGG + Intronic
1172263550 20:33590774-33590796 CAAAAGCTGATGGGCTGACTGGG + Intronic
1172539615 20:35700814-35700836 CGAGAGCTGATGGGCGGCATTGG + Exonic
1175060349 20:56236492-56236514 CAAGATCTGATGGGCTTATTAGG + Intergenic
1178934677 21:36850986-36851008 CCACAGGTGATGGGCAGGGTGGG + Intronic
1179036423 21:37762445-37762467 CCAAGGCTGATGGGCTGGCTGGG + Intronic
1179493284 21:41755478-41755500 CAAGAGCTCAGGGGCAGGGCCGG + Intronic
1179539712 21:42076254-42076276 CCAGGGCTGCTGGGCTGGGGCGG + Intronic
1179913674 21:44462979-44463001 CAGGAGCTGAGGGGCAGGGCAGG - Intergenic
1180765447 22:18343713-18343735 CAAGAGATGATGGCCTGGGTGGG - Intergenic
1180780867 22:18518679-18518701 CAAGAGATGATGGCCTGGGTGGG + Intergenic
1180813583 22:18775986-18776008 CAAGAGATGATGGCCTGGGTGGG + Intergenic
1181199767 22:21210316-21210338 CAAGAGATGATGGCCTGGGTGGG + Intronic
1181399996 22:22645542-22645564 CAAGAGATGATGGCCTGGGTGGG - Intronic
1181585257 22:23849535-23849557 CAAGAGCTGAGGGGCAGGGAGGG + Intergenic
1181649368 22:24250248-24250270 CAAGAGATGATGGCCTGGGTGGG + Intergenic
1181701971 22:24626640-24626662 CAAGAGATGATGGCCTGGGTGGG - Intronic
1182103225 22:27671841-27671863 CCATTGCTGATGGGATGGGTTGG + Intergenic
1182454503 22:30441253-30441275 GGAGTGCTGATGGGTTGGGTCGG + Intergenic
1183540348 22:38426242-38426264 CTAGGCTTGATGGGCTGGGTGGG + Intergenic
1183589006 22:38769251-38769273 CAGGAGGTGAGGGCCTGGGTCGG - Intronic
1183956603 22:41383928-41383950 CAAGCCTTGGTGGGCTGGGTGGG - Intronic
1184197381 22:42939085-42939107 TAAGAGCTGATGGGCTGCGCTGG - Intronic
1184392835 22:44214834-44214856 GAAGAGCAGATGGGCTTGGTAGG - Intronic
1184596541 22:45517421-45517443 CGTGAGCTGAGGGGCTGGGAGGG + Intronic
1184954934 22:47879614-47879636 CAAGAGGCAATGAGCTGGGTGGG - Intergenic
1203227068 22_KI270731v1_random:84603-84625 CAAGAGATGATGGCCTGGGTGGG - Intergenic
1203263683 22_KI270734v1_random:1668-1690 CAAGAGATGATGGCCTGGGTGGG + Intergenic
950029783 3:9844619-9844641 CAAGAGTTGAGGGTCCGGGTGGG - Intronic
950674797 3:14548211-14548233 AAAGAGCAGGTGGGCTGGCTAGG + Intergenic
953341308 3:42136265-42136287 CAAGAGCTGAAGAACAGGGTAGG - Intronic
953515557 3:43587538-43587560 CAAGGGCTGAAGGGAAGGGTTGG + Intronic
954289207 3:49640356-49640378 CGAGAGCTCATGGGCTGCTTTGG + Intronic
954681068 3:52346264-52346286 CCAGAGCTGCTGGGCAGGGAAGG - Intronic
954699829 3:52445398-52445420 TTAAAGTTGATGGGCTGGGTAGG + Intergenic
955625764 3:60917581-60917603 CAAGACCTGAGGGTCTGAGTTGG - Intronic
957149383 3:76465436-76465458 CAATGGCTTATGGGATGGGTGGG - Intronic
957668857 3:83274332-83274354 CAAGATCTGATGGGCTAATTGGG - Intergenic
958133236 3:89456650-89456672 GAAAAGCTGATGGTCAGGGTGGG + Intronic
960352181 3:116607220-116607242 GAAAAGCAGATGGGGTGGGTAGG - Intronic
961445241 3:126977470-126977492 CAGGAGCAGAAGGGCTGTGTGGG + Intergenic
962839107 3:139217696-139217718 CAAGAGCTGATAGTGTGGGAAGG + Intronic
965442970 3:168739000-168739022 CAAGACCAGATGCGCTGGCTGGG - Intergenic
968517881 4:1022493-1022515 TCAGAGGTCATGGGCTGGGTTGG + Intronic
968731518 4:2271450-2271472 CAGGAGCAGGTGGGCTGGGCCGG + Intronic
970000870 4:11364840-11364862 CAAGAGGTGATGTGTTAGGTGGG + Intergenic
970065356 4:12087642-12087664 CCAGAGCTGATGGTCTGTGCTGG + Intergenic
973187284 4:47345222-47345244 CAAGTACTTATAGGCTGGGTGGG + Intronic
974081032 4:57212620-57212642 CAGGGGCTGAGGGGCTGGGGTGG + Intergenic
975175070 4:71279235-71279257 CAAGGGCTGGTGGGATGGGTGGG - Intronic
976217971 4:82732528-82732550 CAGGATCTGATGTGATGGGTAGG - Intronic
978278788 4:106984911-106984933 CAAAAGATTATGGGCTGGGCCGG + Intronic
979713358 4:123807258-123807280 CAAAGGGTGAGGGGCTGGGTAGG + Intergenic
980932923 4:139198704-139198726 GAAGTGCTGATTGGTTGGGTTGG - Intergenic
984159141 4:176229992-176230014 AAAAAGCTGAGGGGCTGGGCAGG + Intronic
985325423 4:188763116-188763138 CAAGGGGTGAGGGGCTGGGGAGG - Intergenic
985427012 4:189840995-189841017 GGAGTGCTGATTGGCTGGGTTGG - Intergenic
986134394 5:4960628-4960650 CAAAAACTGATGGTATGGGTAGG + Intergenic
986972176 5:13349765-13349787 CAAGAGGAGGTGGGCTGGGGAGG - Intergenic
988132193 5:27120178-27120200 CAGGAGCTCATGGAGTGGGTGGG - Intronic
988783752 5:34546990-34547012 CAAGAGATCATAGGATGGGTTGG - Intergenic
990176549 5:53114488-53114510 GAAAAGGGGATGGGCTGGGTAGG + Intergenic
991179174 5:63728884-63728906 CAAGGCCTGGTGAGCTGGGTAGG - Intergenic
991997327 5:72400888-72400910 CAAGAGCTGTGGGTCCGGGTGGG - Intergenic
992093112 5:73337056-73337078 GAAAGACTGATGGGCTGGGTGGG - Intergenic
992376621 5:76194108-76194130 CCAGGGCTCAGGGGCTGGGTGGG + Intronic
993724867 5:91355698-91355720 TGAGAGCTGAAGGGTTGGGTGGG + Intergenic
993776622 5:92007691-92007713 CAAGTTCTGATGAGCTGGATTGG - Intergenic
997322759 5:132992351-132992373 AAAGAGCTGTTGGGCCTGGTGGG - Intergenic
997673786 5:135697358-135697380 CAAGGGTTGTTGGGCTTGGTAGG + Intergenic
997758489 5:136422466-136422488 AAAGAACTGATGTGCTGAGTTGG + Intergenic
998934845 5:147224127-147224149 GAAGGGCTGATGGGCTGGAGTGG + Intergenic
999030197 5:148281903-148281925 GAAGAGATGATAGGATGGGTGGG + Intronic
999804743 5:155071249-155071271 CAAGATCTGATGGGCTTGTCAGG - Intergenic
999857860 5:155614670-155614692 CATGAGCTGACTGGCTGGGTAGG + Intergenic
999932294 5:156446686-156446708 CAAGAAAAGGTGGGCTGGGTAGG + Intronic
1001451686 5:171830516-171830538 CAAGGGCTAAAGGGCTGGATAGG + Intergenic
1004544149 6:16581125-16581147 TAAGAGCTGAGGGGCGGGGTGGG + Intronic
1005398870 6:25411226-25411248 CAATAGTTGAGGGCCTGGGTAGG + Intronic
1006134277 6:31886550-31886572 CCAGAGGGGCTGGGCTGGGTGGG + Intronic
1006151752 6:31993617-31993639 AACGAGGTGAGGGGCTGGGTGGG + Exonic
1006158053 6:32026355-32026377 AACGAGGTGAGGGGCTGGGTGGG + Exonic
1006452180 6:34111669-34111691 CAAGAGCTGATGGGCTGGGTGGG + Intronic
1006517105 6:34551229-34551251 CAACTGCTGTGGGGCTGGGTTGG - Intronic
1006696042 6:35931550-35931572 CAGGAGCTCATGGACGGGGTGGG - Intergenic
1007700318 6:43762574-43762596 TAAGAGCTGACTGGCTGGGTGGG - Intergenic
1007786245 6:44281163-44281185 CAACCCCTGCTGGGCTGGGTGGG + Intronic
1008618300 6:53247019-53247041 CTGGAGCTGGTGGGCTGGCTGGG + Intergenic
1014342761 6:120229588-120229610 CAAGAGCTGCTGGGGAGGGCAGG - Intergenic
1014640942 6:123909601-123909623 CAAGAGAAGCTGGGTTGGGTGGG - Intronic
1015047919 6:128800132-128800154 CAGGGGCTGGTGGGGTGGGTTGG + Intergenic
1015918491 6:138242799-138242821 CAAGAGCTGGTGGGTAGGGGTGG + Intronic
1017247720 6:152245246-152245268 AAGGAGCTGATGGTCTGGTTAGG + Intronic
1018988099 6:168653162-168653184 CAAGAACTGATGGGCTGCCTGGG + Exonic
1021340438 7:19457410-19457432 GAAGCTCTGATGGGTTGGGTGGG + Intergenic
1023438779 7:40165621-40165643 AAAGAACTGATGGGCTGGGTGGG - Intronic
1023584434 7:41714761-41714783 CAAGAGCTGAGGTCATGGGTCGG + Intergenic
1024294946 7:47834175-47834197 CAAGACCTGTTGTGCTGGCTGGG - Intronic
1026100218 7:67378300-67378322 CAGGAGCAGCTGGGCTGGGATGG + Intergenic
1026877288 7:73886942-73886964 CAAGAGATGAAGGACTGGGGGGG - Intergenic
1028472778 7:91223008-91223030 CATTAGCTGATTGGCTGGGAGGG + Intergenic
1029575680 7:101401835-101401857 CAAGAGGTGGTGTCCTGGGTTGG - Intronic
1030472453 7:109982253-109982275 GAAGTGCTGATTGGTTGGGTTGG - Intergenic
1032011229 7:128349438-128349460 CAGGAGCTGATGGGCAAAGTTGG + Intergenic
1032262067 7:130346286-130346308 CAGGAGAGGATGTGCTGGGTTGG + Intronic
1032383888 7:131508277-131508299 GAGGAGCTGATGGGATGGGTGGG - Intronic
1035534022 8:377593-377615 CAAAAGCAGACGGGCTGGCTTGG - Intergenic
1036573101 8:9999137-9999159 CAGGTGCTGATGGGGTGGGAAGG + Intergenic
1036661445 8:10711481-10711503 CCAGGGCTGACTGGCTGGGTGGG + Intronic
1037431958 8:18822969-18822991 CAAGAGCTGATTGATTGGATCGG - Intronic
1037436600 8:18870077-18870099 GGAGAGCTGATGGGTTGGGGAGG + Intronic
1039124224 8:34182928-34182950 CATTAGTTGATGGGTTGGGTAGG + Intergenic
1039194168 8:35011980-35012002 GAAAAGCTGATGAGCTTGGTTGG - Intergenic
1040622194 8:49103083-49103105 CAAGAGCCCATGGCCTGGGTGGG + Intergenic
1040647633 8:49418529-49418551 AGAGTGCTGATTGGCTGGGTTGG - Intergenic
1042286365 8:67116030-67116052 GATGAACTGATGGGATGGGTGGG - Exonic
1042967420 8:74369906-74369928 AAAGTGCTGATGGGGTGGGAAGG + Intronic
1045498525 8:102728188-102728210 TAAGAGGTGCTAGGCTGGGTTGG + Intergenic
1047925900 8:129682395-129682417 CAAGAGATGATGGGCTGCCGTGG - Intergenic
1048871636 8:138804022-138804044 CAGGAGCTGAGGGGCTGAGAGGG - Intronic
1048966383 8:139617950-139617972 GCAGAGATGATGGGGTGGGTGGG + Intronic
1049408545 8:142462341-142462363 CAAGAGATTAAGAGCTGGGTGGG - Intronic
1049553193 8:143270129-143270151 CAGCAGCTCATGTGCTGGGTTGG - Intronic
1049772624 8:144390781-144390803 CATGAGGTGGTGGGCTGGGTGGG + Intronic
1049797810 8:144504546-144504568 CAAGGGCTGAGGGGTTAGGTAGG + Intronic
1050190779 9:3023627-3023649 CAGAAGCTGATGAGCTGAGTGGG - Intergenic
1051802005 9:20945454-20945476 CAATAGCTCATGGGCAGGCTGGG - Intronic
1051825025 9:21210618-21210640 GTAGAGCTGCTGGGCTGGGCTGG - Intronic
1052527458 9:29636847-29636869 CAAGAGCTGTCAGGCAGGGTAGG - Intergenic
1052985313 9:34482845-34482867 CAAGAGCCCATGGAGTGGGTGGG + Intronic
1055240175 9:74174542-74174564 CAACAGCTGATTGAGTGGGTTGG + Intergenic
1055890996 9:81123075-81123097 CAAGAGCAGGTGGGCTGCCTGGG + Intergenic
1056063125 9:82905337-82905359 AAAGAGCTGAGGGTTTGGGTGGG - Intergenic
1056533381 9:87506953-87506975 CTAGAGTTAATGTGCTGGGTGGG + Intronic
1056919628 9:90774604-90774626 CATGAGCAGCTGGGCTGGGGCGG + Intergenic
1058936010 9:109770123-109770145 GAGGAGCTCTTGGGCTGGGTCGG + Intronic
1059162013 9:112043426-112043448 GAAGTGCTGATTGGTTGGGTTGG - Intronic
1060053009 9:120390420-120390442 CAAGAGCTGGTTGGGTGGGATGG + Intronic
1060379510 9:123153751-123153773 CAAGAGCTGGTAGTCTGGGATGG + Intronic
1060484198 9:124036905-124036927 AAAGAGGAGATGGGTTGGGTTGG + Intergenic
1061519601 9:131110316-131110338 CAGGACCAGATGGGCAGGGTGGG - Intronic
1061538441 9:131264183-131264205 AAAGAGCTGAAGGTCTGGTTTGG + Intronic
1061956116 9:133962122-133962144 GAGGAGCTGGTGGGCAGGGTGGG - Intronic
1062068156 9:134540015-134540037 CGCGAGCAGATGGGCTGGGTAGG - Intergenic
1062208361 9:135349467-135349489 CCTGAGCTGATGAGCTGGGAAGG - Intergenic
1062342673 9:136100700-136100722 CAAGACCTGATGTTCTGAGTGGG - Intergenic
1062378950 9:136277493-136277515 CAGGTGCTGAGGGGGTGGGTGGG + Intergenic
1185983649 X:4806854-4806876 AGAGAGCTGATTGGTTGGGTTGG + Intergenic
1186039070 X:5456575-5456597 GGAGAGCTGATTGTCTGGGTTGG - Intergenic
1187592672 X:20735457-20735479 GAAGAGGGGCTGGGCTGGGTAGG + Intergenic
1187719358 X:22135242-22135264 CAAGAGCACATGGGCTGTGATGG + Intronic
1192437738 X:71153318-71153340 CAAGAACTGAGGGAATGGGTGGG - Intronic
1195217064 X:102712748-102712770 CAAGGGCTGAGGGGCTGGCTCGG + Intronic
1195807549 X:108792843-108792865 CTGGAGCTGATGGGGTGGGCAGG - Intergenic
1196844513 X:119887868-119887890 CAGGAGCCGATGGGCGGGGTCGG - Intergenic
1197042950 X:121962119-121962141 AAAGTGCTGAGGGGTTGGGTTGG + Intergenic
1197116899 X:122844237-122844259 CAAGGAATGATGGGCTTGGTTGG + Intergenic
1198042991 X:132872994-132873016 CAGGAAGTGATGGGCTGGGTTGG - Intronic
1199980415 X:152917524-152917546 CCAGAGGAGATGGGCTGGGGTGG + Intronic
1200169918 X:154065100-154065122 CAAGAGCCTTTGGGGTGGGTGGG - Intronic
1200423531 Y:2998457-2998479 CAGGAGCTCATGGAGTGGGTGGG + Intergenic
1200512646 Y:4099395-4099417 CAGGAGCTCATGGAGTGGGTGGG - Intergenic
1201362148 Y:13164259-13164281 CAAGAGCTGATTTGGTGGCTGGG + Intergenic
1201493650 Y:14570053-14570075 CTAAAGCTAATGGGCTGAGTGGG + Intronic