ID: 1006453324

View in Genome Browser
Species Human (GRCh38)
Location 6:34117848-34117870
Sequence GGAAATACATAGATGCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006453318_1006453324 19 Left 1006453318 6:34117806-34117828 CCAAGGCTGCACTGTCGCATCTC 0: 1
1: 0
2: 1
3: 27
4: 158
Right 1006453324 6:34117848-34117870 GGAAATACATAGATGCAGCCAGG No data
1006453316_1006453324 26 Left 1006453316 6:34117799-34117821 CCAGCACCCAAGGCTGCACTGTC 0: 1
1: 1
2: 1
3: 21
4: 227
Right 1006453324 6:34117848-34117870 GGAAATACATAGATGCAGCCAGG No data
1006453322_1006453324 -3 Left 1006453322 6:34117828-34117850 CCTCATGGAGAGAGGCCACTGGA 0: 1
1: 0
2: 2
3: 21
4: 207
Right 1006453324 6:34117848-34117870 GGAAATACATAGATGCAGCCAGG No data
1006453315_1006453324 27 Left 1006453315 6:34117798-34117820 CCCAGCACCCAAGGCTGCACTGT 0: 1
1: 1
2: 1
3: 18
4: 292
Right 1006453324 6:34117848-34117870 GGAAATACATAGATGCAGCCAGG No data
1006453317_1006453324 20 Left 1006453317 6:34117805-34117827 CCCAAGGCTGCACTGTCGCATCT 0: 1
1: 0
2: 0
3: 13
4: 118
Right 1006453324 6:34117848-34117870 GGAAATACATAGATGCAGCCAGG No data
1006453314_1006453324 30 Left 1006453314 6:34117795-34117817 CCACCCAGCACCCAAGGCTGCAC 0: 1
1: 0
2: 5
3: 47
4: 420
Right 1006453324 6:34117848-34117870 GGAAATACATAGATGCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006453324 Original CRISPR GGAAATACATAGATGCAGCC AGG Intronic
No off target data available for this crispr