ID: 1006454199

View in Genome Browser
Species Human (GRCh38)
Location 6:34122687-34122709
Sequence TCAGTTCCACACCAAGGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 202}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006454188_1006454199 26 Left 1006454188 6:34122638-34122660 CCTGCAGACTAAGGGGGGTCCAC 0: 1
1: 0
2: 0
3: 1
4: 71
Right 1006454199 6:34122687-34122709 TCAGTTCCACACCAAGGCCCCGG 0: 1
1: 0
2: 0
3: 14
4: 202
1006454191_1006454199 7 Left 1006454191 6:34122657-34122679 CCACCCCTGCTGCGGGCACCATC 0: 1
1: 0
2: 4
3: 36
4: 272
Right 1006454199 6:34122687-34122709 TCAGTTCCACACCAAGGCCCCGG 0: 1
1: 0
2: 0
3: 14
4: 202
1006454187_1006454199 27 Left 1006454187 6:34122637-34122659 CCCTGCAGACTAAGGGGGGTCCA 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1006454199 6:34122687-34122709 TCAGTTCCACACCAAGGCCCCGG 0: 1
1: 0
2: 0
3: 14
4: 202
1006454194_1006454199 2 Left 1006454194 6:34122662-34122684 CCTGCTGCGGGCACCATCCTGTT 0: 1
1: 0
2: 0
3: 8
4: 137
Right 1006454199 6:34122687-34122709 TCAGTTCCACACCAAGGCCCCGG 0: 1
1: 0
2: 0
3: 14
4: 202
1006454192_1006454199 4 Left 1006454192 6:34122660-34122682 CCCCTGCTGCGGGCACCATCCTG 0: 1
1: 0
2: 2
3: 14
4: 234
Right 1006454199 6:34122687-34122709 TCAGTTCCACACCAAGGCCCCGG 0: 1
1: 0
2: 0
3: 14
4: 202
1006454193_1006454199 3 Left 1006454193 6:34122661-34122683 CCCTGCTGCGGGCACCATCCTGT 0: 1
1: 0
2: 1
3: 19
4: 131
Right 1006454199 6:34122687-34122709 TCAGTTCCACACCAAGGCCCCGG 0: 1
1: 0
2: 0
3: 14
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006454199 Original CRISPR TCAGTTCCACACCAAGGCCC CGG Intronic
900138954 1:1131036-1131058 CAGGTTCCATACCAAGGCCCCGG - Intergenic
900635479 1:3662801-3662823 TCAGCTCCCCACCAGGCCCCAGG + Intronic
900762302 1:4481587-4481609 TCAGTTCCACATCCGAGCCCTGG + Intergenic
901214861 1:7549504-7549526 TCATTTCCTCTCCAATGCCCTGG + Intronic
902197985 1:14812248-14812270 TCAGTCCCACACCATGACACGGG + Intronic
908332286 1:63082703-63082725 TGAGGACTACACCAAGGCCCTGG + Intergenic
908436770 1:64114574-64114596 TCTGCTCCACAACAGGGCCCAGG + Intronic
912522290 1:110253973-110253995 TCAGTTGCAGACCAAGCTCCAGG + Intronic
912580874 1:110719822-110719844 TCAGTTCCTCACCAACACCCAGG - Intergenic
916493339 1:165322308-165322330 GCAATTCCACACCTAGGCACAGG + Intronic
917752513 1:178066595-178066617 CCAGTACCAGTCCAAGGCCCAGG + Intergenic
920035240 1:203061058-203061080 TCAGTCCCAACCCCAGGCCCAGG - Intronic
922163058 1:223092507-223092529 TTACTTCCACACCACAGCCCAGG + Intergenic
1063089022 10:2845193-2845215 GAAGTTCAAGACCAAGGCCCTGG - Intergenic
1064139025 10:12774628-12774650 TCAGTATCAGTCCAAGGCCCAGG - Intronic
1065558195 10:26937191-26937213 GCAGTGCCACCCCATGGCCCAGG - Intergenic
1065558743 10:26941577-26941599 GCAGTGCCACCCCATGGCCCAGG - Intergenic
1072803840 10:98411647-98411669 CACGTTCCACACCAAGCCCCTGG + Intronic
1073216538 10:101839864-101839886 TAAGCTCCACCCCCAGGCCCCGG + Intronic
1073659937 10:105463665-105463687 TCAGTACCAGTCCATGGCCCAGG - Intergenic
1075099117 10:119493468-119493490 TCAGATCATAACCAAGGCCCGGG - Intergenic
1075656873 10:124167833-124167855 TCCTCTCCCCACCAAGGCCCAGG - Intergenic
1077103893 11:833580-833602 TCTGTTCCTCCCCAAGTCCCCGG - Intronic
1077836305 11:5930565-5930587 TCAGCTCCAAACCCAGGCCCTGG + Intronic
1078605274 11:12769597-12769619 CCATTTCCACACCAGGGCTCTGG - Intronic
1079078119 11:17396163-17396185 CCAGACCCACACCAAGGCCCAGG - Intronic
1079212197 11:18472145-18472167 TCTGTTCCAGACCCAGGGCCTGG + Intronic
1079395095 11:20055550-20055572 TCAGCTCCAAAGCAAGGCTCTGG - Intronic
1079445204 11:20550732-20550754 TCACTCCCACCCCAAGCCCCAGG - Intergenic
1085618110 11:78017216-78017238 TGAGTTCCACACCACCACCCTGG - Exonic
1089741323 11:120586543-120586565 TCTAATTCACACCAAGGCCCTGG - Intronic
1091268716 11:134290624-134290646 TCAACTCCACTCCCAGGCCCAGG + Intronic
1092265178 12:6975487-6975509 ACAGTTCCACACCCTGCCCCAGG + Intronic
1093430829 12:19083027-19083049 TCATCTCCACAGAAAGGCCCTGG - Intergenic
1094493660 12:30976566-30976588 TCAGTACCACACGCAGACCCAGG + Intronic
1095633017 12:44400019-44400041 TAAGCTCCACAGGAAGGCCCAGG + Intergenic
1096215966 12:49797444-49797466 CCAGTTCCAGGCCCAGGCCCTGG + Intronic
1096386174 12:51196804-51196826 TCAGATCCTCACCAATGCTCAGG - Exonic
1098193839 12:67978458-67978480 TCAGATCCACAGCAATGCCTGGG + Intergenic
1100260409 12:92928488-92928510 TCAGTCCCACGCCTGGGCCCAGG + Intronic
1100785389 12:98072857-98072879 TCACTTTCACATGAAGGCCCAGG + Intergenic
1101521055 12:105482705-105482727 ACAGTCCTACACCAAGGCCTTGG + Intergenic
1101739527 12:107490183-107490205 TTAGTTCCACTCCACCGCCCAGG + Intronic
1102439292 12:112949058-112949080 TCAGATCCCCACCAAGGAGCTGG + Exonic
1102606968 12:114075311-114075333 TCAATTCCACAGCAGAGCCCTGG + Intergenic
1106525204 13:30534279-30534301 TCAGTCACACTCCACGGCCCAGG + Intronic
1107127169 13:36858242-36858264 CCAGATCCACACCAGGGCCTAGG + Intronic
1107958271 13:45538476-45538498 TTAGTTCCACACCTATGCTCAGG - Intronic
1110274889 13:73632359-73632381 TCAGTACCACTCCTAGACCCAGG + Intergenic
1111978050 13:94988086-94988108 TCAGGCCCACACCAAGTCCAGGG + Intergenic
1112923433 13:104643660-104643682 ACATTTCCACACCAAGGGCCAGG - Intergenic
1113418444 13:110150644-110150666 CCAGCTGCACACCCAGGCCCTGG + Intronic
1115876701 14:37869421-37869443 TCAGATCTAGACCAGGGCCCTGG - Intronic
1118317143 14:64732312-64732334 ACAGTGCTGCACCAAGGCCCGGG - Intronic
1122941220 14:104982231-104982253 TCGGCTCCTCACCCAGGCCCCGG - Intergenic
1127593412 15:60451743-60451765 TCAGTTTTCCACCAAGGGCCTGG - Intronic
1128222333 15:65978104-65978126 CCAGTTCCACACAATGGCCTGGG + Intronic
1131119293 15:89813130-89813152 TCAGCCGCACACCGAGGCCCTGG - Intronic
1131300587 15:91196412-91196434 TCACTTCCTCTCCAAGGCCTTGG - Intronic
1131886969 15:96926500-96926522 TCAGTTCCACAAAAATGCACAGG + Intergenic
1132045969 15:98562996-98563018 TCAGCCCCACAGCAAGCCCCAGG - Intergenic
1137959291 16:52865515-52865537 CTAGTTGCACACAAAGGCCCAGG - Intergenic
1142155216 16:88529932-88529954 CCAGGTCCACACCTAAGCCCAGG + Intronic
1143265734 17:5635726-5635748 CCAGTTCCCCATCAAGGCCAGGG - Intergenic
1144889971 17:18488999-18489021 TCTGTTTCCCACCCAGGCCCAGG + Exonic
1144889982 17:18489038-18489060 TGAGTTCAACACAGAGGCCCTGG + Intronic
1145142234 17:20455279-20455301 TGAGTTCAACACAGAGGCCCTGG - Intronic
1145142245 17:20455318-20455340 TCTGTTTCCCACCCAGGCCCAGG - Exonic
1145793666 17:27643583-27643605 TCTGTTTCCCACCCAGGCCCAGG + Exonic
1145793677 17:27643622-27643644 TGAGTTCAACACAGAGGCCCTGG + Intronic
1145808477 17:27751139-27751161 TCTGTTTCCCACCCAGGCCCAGG + Intergenic
1145808488 17:27751178-27751200 TGAGTTCAACACAGAGGCCCTGG + Intergenic
1148406948 17:47423982-47424004 CCAGTTGCACCCCAAGGGCCGGG + Intronic
1148441741 17:47715062-47715084 TCAGCCCCACAGCAGGGCCCTGG + Intergenic
1149977602 17:61282320-61282342 TCAGCTCCCAACCAAGGCTCAGG - Intronic
1150163249 17:62917009-62917031 TCATTTCCACACTAAAGCCAAGG + Intergenic
1150361038 17:64534343-64534365 TCAGTTCCACAGGAGTGCCCAGG + Intronic
1152122392 17:78426773-78426795 GCAGTTCCAGAACAAGCCCCGGG - Intronic
1154045595 18:10901962-10901984 CCAGTACCAGTCCAAGGCCCAGG - Intronic
1155056109 18:22185280-22185302 TCAGTTCCCCACCAGAGGCCAGG + Intronic
1155798092 18:30065408-30065430 TCATTTCTTCACCAAAGCCCTGG + Intergenic
1156855980 18:41781664-41781686 TCAGTACCCCAGCCAGGCCCTGG - Intergenic
1158547923 18:58411554-58411576 TCAGTCCCACACCAAGAAGCAGG - Intergenic
1158887242 18:61840006-61840028 TCAGTTAGAAACCAAGGCCTGGG + Intronic
1160488871 18:79320217-79320239 TCAGTTCCCCACACAGGTCCAGG - Intronic
1160686378 19:438819-438841 TCAGGCCCCCAACAAGGCCCTGG - Exonic
1161767664 19:6216228-6216250 CCAGGCCCACCCCAAGGCCCAGG + Intronic
1162743425 19:12786206-12786228 TCAGATCCACACCCAGGGGCAGG + Intronic
1163290564 19:16376784-16376806 TCAGTGCCACCCCGACGCCCTGG - Intronic
1163796736 19:19342276-19342298 TGGGTCCAACACCAAGGCCCAGG - Intronic
1164645966 19:29858902-29858924 TCCCTTCCCCACCAAAGCCCCGG - Intergenic
926118757 2:10229601-10229623 TCATTTCCACGTCCAGGCCCTGG + Intergenic
927229750 2:20810708-20810730 CCAGTTCCAGACCATGGCCCAGG - Intronic
931439007 2:62274108-62274130 TCAGTCCCACAAGAAGTCCCAGG - Intergenic
931951406 2:67367197-67367219 TCACTTCCACTCCCAGCCCCAGG + Intergenic
934662416 2:96150200-96150222 TCCCTTCCACCCCCAGGCCCAGG - Intergenic
935686960 2:105692405-105692427 TCATTTCCACACCCAGGATCTGG - Intergenic
938917942 2:135963038-135963060 TCAGTGCTACACAAAGACCCTGG + Intronic
943613577 2:190065279-190065301 TCAGTGCCTCACCCAGTCCCTGG - Intronic
944992100 2:205249525-205249547 TCAGATCCAATCAAAGGCCCAGG + Intronic
945497342 2:210525139-210525161 TCTGTGCCACACCAAGGACAAGG + Intronic
946354907 2:219178415-219178437 TCAGACCCAGACCCAGGCCCAGG - Exonic
948104809 2:235405177-235405199 TCACATCCACACCAAGGGCTTGG - Intergenic
948129690 2:235591394-235591416 TGCGTTTCACACCAAGACCCGGG - Intronic
948349574 2:237327498-237327520 CCAGTTCCACACCACGGCACTGG + Intronic
1169772944 20:9221238-9221260 TCTGTTCCACATCAAGGCAATGG + Intronic
1171171378 20:23018217-23018239 TCATTTCCTGACCAAGGCCTAGG - Intergenic
1171317132 20:24205272-24205294 TCTCTTTCACTCCAAGGCCCTGG - Intergenic
1171486987 20:25492389-25492411 GCAGATCCACACAAAGACCCAGG + Intronic
1174445709 20:50589742-50589764 GCTGTTCTACACCAACGCCCTGG - Exonic
1175737333 20:61396342-61396364 TCAGTTCCATACACAGTCCCAGG - Intronic
1176290058 21:5038879-5038901 TCAGTGGCCCACCATGGCCCAGG + Intronic
1177519332 21:22197629-22197651 TCAGTGCCACACCCTGGGCCTGG + Intergenic
1178347174 21:31840160-31840182 TCAGTTCAACAGAAAGGACCTGG + Intergenic
1178457804 21:32771697-32771719 TCGCTTCCACACCGCGGCCCCGG + Exonic
1179867196 21:44224760-44224782 TCAGTGGCCCACCATGGCCCAGG - Intronic
1180205978 21:46260845-46260867 TCAGCTCCACGGCCAGGCCCTGG + Exonic
1181773108 22:25140964-25140986 GAAGTTCCACAGCAAGTCCCAGG - Intronic
1182104836 22:27681890-27681912 ACACTTCCTCACCAGGGCCCTGG - Intergenic
1183946021 22:41326210-41326232 TCAGACTCCCACCAAGGCCCAGG - Intronic
1184381052 22:44145179-44145201 TTAGTTCCACACCAAGAGCGAGG + Intronic
1184677061 22:46049421-46049443 ACAGTCCCACACCACAGCCCTGG + Intergenic
1184695443 22:46136529-46136551 CCAGCTCCACACCAAGTACCTGG - Intergenic
950125495 3:10507402-10507424 TCAGCTCCACCCCAGGGACCAGG + Intronic
954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG + Intronic
954181036 3:48881525-48881547 GGACTTCCACCCCAAGGCCCTGG + Intronic
955199906 3:56842139-56842161 TCAGTTCCTCCCCAACGCCCAGG + Intronic
958120910 3:89286749-89286771 TCATTTCCTCACCCAAGCCCAGG - Intronic
960971005 3:123140170-123140192 TCATTTCTACCCCAGGGCCCTGG - Intronic
961269800 3:125680322-125680344 TCAGGTGAACACCAAGCCCCAGG + Intergenic
962485250 3:135836140-135836162 CAAGTACCACACCTAGGCCCCGG - Intergenic
962888385 3:139649500-139649522 TCAGTTTCACACAAAAGCCAAGG + Intronic
964824665 3:160811947-160811969 TCAGTGCCACACCAAGTGCCTGG - Intronic
969817552 4:9697724-9697746 TCATAGCCACACCCAGGCCCTGG + Intergenic
969931820 4:10638058-10638080 GCAGGTCCAAACCAAGGCACTGG + Intronic
972281050 4:37602487-37602509 TCAGTTCCACAGCAAGCAACTGG + Intronic
977039600 4:92000241-92000263 TCAGTTACACTCCAAAGCCAGGG + Intergenic
978296555 4:107211907-107211929 TTAGTTCCACTGGAAGGCCCAGG - Intronic
979014500 4:115416261-115416283 TCTGTTCTACCCCAAGACCCAGG + Intergenic
979423973 4:120542103-120542125 TCAGCTCAACACCAAAGCCCAGG - Intergenic
979931848 4:126641580-126641602 TATTTTCCTCACCAAGGCCCTGG - Intergenic
980508274 4:133752312-133752334 TCAGTACCAGTCCATGGCCCAGG - Intergenic
982657501 4:158168670-158168692 TCAGTCCAACTCCACGGCCCAGG + Intronic
986211475 5:5676981-5677003 TCAGATGCCCCCCAAGGCCCTGG - Intergenic
989799008 5:45512657-45512679 TCAGTGCCACACCATGACCTGGG - Intronic
994252416 5:97551799-97551821 TCAGTTCCACTCTGTGGCCCAGG - Intergenic
997368494 5:133340987-133341009 TCAAAACCACCCCAAGGCCCAGG + Intronic
998225167 5:140321382-140321404 TCAGCTCCACACCCATGCACTGG + Intergenic
1001914600 5:175549164-175549186 TCAGGTTCCCACCAAGTCCCAGG + Intergenic
1002494502 5:179602550-179602572 TGTGATCCACCCCAAGGCCCAGG - Intronic
1002576015 5:180174112-180174134 TCAAGCCCACACCACGGCCCAGG - Intronic
1002761955 6:209298-209320 CCAGCTCCCCATCAAGGCCCTGG + Intergenic
1002934267 6:1658359-1658381 TATGTTCCTCAGCAAGGCCCAGG - Intronic
1003043301 6:2709501-2709523 TCAGGGCCACAGCAAGCCCCAGG + Intronic
1004884964 6:20042526-20042548 CCAGGTCCAAATCAAGGCCCAGG - Intergenic
1004884970 6:20042544-20042566 CCAGGACCAAACCAAGGCCCAGG - Intergenic
1006009982 6:31034728-31034750 TCAGGTCCAGACCAAGGCTGTGG - Exonic
1006454199 6:34122687-34122709 TCAGTTCCACACCAAGGCCCCGG + Intronic
1006891618 6:37433666-37433688 GCAGTGCCAAACCGAGGCCCAGG + Intronic
1007274598 6:40663946-40663968 TCAGTCCCACACCCAGGCAGGGG - Intergenic
1007519915 6:42444024-42444046 CCAGCTCTACACCAAGGCTCTGG - Intronic
1007781784 6:44258476-44258498 TCATTTCCACAGCAAGGACAAGG + Exonic
1008691240 6:53981614-53981636 CCAGTACCAGTCCAAGGCCCAGG - Intronic
1010042498 6:71402280-71402302 TCAGTTCCAGACCCAGGGCCTGG + Intergenic
1017828039 6:158097084-158097106 TCAGTAGCACACCATGGCTCAGG - Exonic
1019542826 7:1559269-1559291 CCAGTCCCACACCCTGGCCCTGG + Intronic
1021554787 7:21908351-21908373 TCAGTTCCCCACCAAGAAGCTGG - Exonic
1022276539 7:28860876-28860898 TCTGGTCAACACCAAGGTCCAGG - Intergenic
1022802987 7:33793315-33793337 TAAGGTCTACACCAAGGCACAGG + Intergenic
1023662981 7:42489664-42489686 TCAGTTCCTCTCCCAGGCCTGGG - Intergenic
1024242030 7:47443098-47443120 TCAGTTCTACACCAAGGTGCCGG + Intronic
1024268032 7:47621574-47621596 CCAGTTACCCAACAAGGCCCAGG + Intergenic
1024563287 7:50662157-50662179 TCAGTTGAAGACCAAGCCCCTGG + Intronic
1025712377 7:63925399-63925421 GCAGGTCCACACCAGGACCCCGG + Intergenic
1025806521 7:64838523-64838545 TCAGCTCCAAACCCAAGCCCTGG - Intergenic
1026435231 7:70390912-70390934 TCAGAATCACCCCAAGGCCCAGG - Intronic
1026804555 7:73421885-73421907 CCAGGCCCACACCCAGGCCCTGG + Intergenic
1027183525 7:75955771-75955793 TCAGTTCCAGTCCAAGGCTGTGG + Intronic
1029255780 7:99268557-99268579 TCAGTTCCAGGGGAAGGCCCAGG + Intergenic
1029342339 7:99955391-99955413 TCAGATCCCCTCCAAGTCCCAGG + Intergenic
1029552851 7:101247012-101247034 TTTGTGCCACCCCAAGGCCCAGG - Intronic
1030071289 7:105699999-105700021 TCAGCTCCACGCCATGGTCCAGG - Intronic
1031605636 7:123764006-123764028 ACAGTTTCACTCCAATGCCCAGG + Intergenic
1032452523 7:132045514-132045536 ACAGTGCTACACCAGGGCCCAGG + Intergenic
1032518138 7:132522073-132522095 TCAGATCCACTGCAAGACCCAGG + Intronic
1034734050 7:153412517-153412539 TCAGCTCCAAACCCAAGCCCTGG - Intergenic
1035700834 8:1638417-1638439 TGAGTCCCAGACCAAGGCGCTGG - Intronic
1038815875 8:30903439-30903461 TGAGTTCCACAAAAAGGCCAAGG + Intergenic
1039888760 8:41670693-41670715 TCAGTCCCACCCTGAGGCCCAGG - Intronic
1046395512 8:113633770-113633792 TCACTTGCACACTGAGGCCCAGG - Intergenic
1048209435 8:132442672-132442694 TCAGTTGAAGACCAAGGCCCGGG - Intronic
1049578630 8:143400896-143400918 CCAGCTGCACACCCAGGCCCTGG - Intergenic
1050040987 9:1493464-1493486 TATGTTGCACTCCAAGGCCCAGG + Intergenic
1051578261 9:18642581-18642603 TCACTTCCACCCCAACCCCCTGG + Intronic
1051614557 9:18994789-18994811 GCAGTTCCACACTAACCCCCAGG + Intronic
1055966276 9:81868157-81868179 TCACTTCCACAGCAATGCACTGG - Intergenic
1057195104 9:93112240-93112262 CCAGTCCCACAGCAAGGCCCAGG - Exonic
1058356915 9:104094057-104094079 TCAGCCCCACACCTCGGCCCCGG - Intergenic
1058668918 9:107344249-107344271 TCAGTCCCAGACTCAGGCCCTGG - Intergenic
1059190380 9:112320009-112320031 TCAGTTTCACCCCCAGCCCCTGG - Intronic
1059341275 9:113598823-113598845 TCTGCTCCACACCCAGGCCCTGG - Intergenic
1060396244 9:123318938-123318960 TCAGCTCCACGCCAAGCCCTGGG - Intergenic
1061481984 9:130901911-130901933 TCTGTTCCACAGCCAAGCCCTGG + Intergenic
1061742366 9:132716543-132716565 TCAGTTCCAAGCCCAGGCCTGGG - Intergenic
1061838383 9:133343691-133343713 TCAGGTCCACACCTATGTCCAGG - Intronic
1187570543 X:20496345-20496367 CCAGTACCAGTCCAAGGCCCAGG - Intergenic
1188194132 X:27209619-27209641 ACACTTCCACACCCAGCCCCAGG - Intergenic
1189161200 X:38810803-38810825 ACAGCTCCCCACCAAGCCCCAGG - Intergenic
1190061166 X:47212595-47212617 TCTGATCCCCACAAAGGCCCGGG - Intronic
1190524887 X:51318871-51318893 TCAGTTATGCAGCAAGGCCCTGG - Intergenic
1190765455 X:53472585-53472607 TCAGATGCCCACCATGGCCCTGG - Intergenic
1192192053 X:68996850-68996872 TCTGTCCTACTCCAAGGCCCTGG + Intergenic
1194765559 X:97843447-97843469 ACAGTTCCAGACCCAGGCCTTGG + Intergenic
1197715771 X:129705084-129705106 CCAGTTCCACAGTAGGGCCCTGG - Intergenic
1199975127 X:152890285-152890307 TCAGTTAAACACCTAGGCCTTGG + Intergenic
1201770167 Y:17611333-17611355 TCAGCTCCAAACCCAAGCCCTGG + Intergenic
1201831387 Y:18294654-18294676 TCAGCTCCAAACCCAAGCCCTGG - Intergenic