ID: 1006454298

View in Genome Browser
Species Human (GRCh38)
Location 6:34123150-34123172
Sequence CTTGCCAGTGAAGCAACCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006454298 Original CRISPR CTTGCCAGTGAAGCAACCTG TGG (reversed) Intronic
901142291 1:7042996-7043018 CAGGCCAGTGAAGAAACTTGGGG - Intronic
902977883 1:20101986-20102008 CTCCCCAGTGATGCAACCGGTGG + Intergenic
904869798 1:33609319-33609341 CTTGCCAGAGAAGAATACTGAGG - Intronic
908246158 1:62229014-62229036 CTTGCCAGTGACCCAGGCTGGGG - Intergenic
908267710 1:62395334-62395356 CTTGCCAGTGATCCAGGCTGAGG + Intergenic
908494122 1:64677734-64677756 ATTGGCAGTGAGGAAACCTGTGG + Intronic
908773543 1:67617677-67617699 CTTGCTGGAGAAGCATCCTGGGG + Intergenic
908909736 1:69059335-69059357 CTTGCCAGTGCCACAGCCTGAGG - Intergenic
910534973 1:88287299-88287321 ATTCCCAGTGGAGCATCCTGGGG - Intergenic
912495413 1:110088540-110088562 CTTGCCAGTGGAGAAGCCAGTGG - Intergenic
912665026 1:111571109-111571131 CTAGCCAGTGATTAAACCTGAGG - Intronic
913444270 1:118933198-118933220 CTTGCCAGAGATGCTGCCTGGGG - Intronic
915670786 1:157486895-157486917 CTTGCCAGGGAAGGCACCTCAGG + Intergenic
917634180 1:176918917-176918939 ATGGCCAGTGTAGAAACCTGTGG - Intronic
918187264 1:182139264-182139286 CTTTCCAGTGAAGCAATCTGGGG - Intergenic
919384260 1:196898885-196898907 GTTGCCATTCAAGCAACCTGTGG - Intronic
921357232 1:214296692-214296714 TTTGACAGTGAAGGAAACTGAGG + Intronic
921940415 1:220833079-220833101 CTTTACAGTGAAGGAAACTGAGG - Intergenic
922643588 1:227261831-227261853 TTGTCCAGTGAAGCAACCTAGGG + Intronic
924090314 1:240494252-240494274 CTTTACAGTGAAGGAAACTGAGG + Intronic
1064480933 10:15739872-15739894 TTTGCCAACGAAGCGACCTGAGG - Intergenic
1070377625 10:75849040-75849062 CATGCCAGAGAAGCTACCAGAGG - Intronic
1071051267 10:81451369-81451391 CTTGCCAGTGGAACAATCAGTGG + Intergenic
1074854798 10:117465594-117465616 CTTGCCAGTGCCCCAGCCTGAGG - Intergenic
1075246114 10:120823411-120823433 TTTGACAGTGCAGCAAGCTGTGG - Intergenic
1075411787 10:122233812-122233834 GTTGCCAGTGGTGCCACCTGTGG + Intronic
1075544748 10:123346563-123346585 CTTGCCAAGGAAGGAACCTTTGG - Intergenic
1075548312 10:123373017-123373039 CTTTCCGGAGAAGGAACCTGAGG + Intergenic
1075938295 10:126363541-126363563 CATGTCAGGGAAGCAAACTGGGG - Intronic
1077335979 11:2004695-2004717 CTTGCCAGTGAAGCGACTGCTGG + Intergenic
1079245066 11:18745832-18745854 CTTACCAGCTAAGCAACCTTGGG - Intronic
1080056491 11:27911902-27911924 CTTGACAAAGAAGCAAACTGGGG + Intergenic
1080683911 11:34499921-34499943 TTTACCAGTGAAGGAAACTGAGG - Intronic
1081071884 11:38620940-38620962 CTTTCCAGTGAAGCAAAATGTGG - Intergenic
1081778240 11:45691728-45691750 CTTGGTAGGGAAGCAAGCTGAGG - Intergenic
1083265562 11:61545313-61545335 CTGGCAAGTGAAGCTAGCTGGGG + Intronic
1086533058 11:87809406-87809428 CTTGCCAGGGCTGCAACCTGTGG + Intergenic
1202818963 11_KI270721v1_random:59877-59899 CTTGCCAGTGAAGCGACTGCTGG + Intergenic
1096637928 12:52973146-52973168 CATCCCAGTGCAGCAGCCTGGGG + Intergenic
1107267939 13:38579625-38579647 CATGCCATGGAAGCAGCCTGGGG + Intergenic
1112799634 13:103096364-103096386 ATTGTCAGTGAAGGATCCTGGGG - Intergenic
1114605830 14:23995379-23995401 CATGCCAGGGAAGAAGCCTGGGG - Intronic
1117250060 14:53928029-53928051 ATTGCCAGAAAAGCAACGTGAGG + Intergenic
1119090876 14:71779893-71779915 CTTGCAGGTGAAGCAACCAGCGG - Intergenic
1120593910 14:86410491-86410513 CTTGAAAGTCATGCAACCTGAGG + Intergenic
1122403277 14:101480209-101480231 CTTACCAGTTAAGTGACCTGGGG + Intergenic
1127386534 15:58471882-58471904 CTCCCCAGTGAAGCTCCCTGAGG + Intronic
1131254312 15:90851932-90851954 CTTTCCAGTGAAGCAACCTTGGG + Intergenic
1131788932 15:95943141-95943163 CTCCCCAGTGGAGAAACCTGGGG + Intergenic
1132328090 15:100988679-100988701 CTTGCCAGCGAGGGCACCTGGGG + Exonic
1138237530 16:55397576-55397598 CTGGCCAGTGGGGCAACATGAGG - Intronic
1140606697 16:76547772-76547794 ATTGCCACTGCAGAAACCTGAGG - Intronic
1141740250 16:85886993-85887015 CTTTCCAATGTAGCAACCTTGGG + Intergenic
1142596438 17:1032013-1032035 CTTGCCAGGGATGAAACCCGGGG - Intronic
1144711948 17:17407004-17407026 CTTGCTTGTGATGCAACCTACGG - Intergenic
1146468849 17:33108524-33108546 CTTGTCTGTAAAGCCACCTGAGG - Intronic
1148442570 17:47719362-47719384 CTTGCCAGTAAAGTAGCCAGGGG + Intergenic
1149331975 17:55592775-55592797 ATTTTCAGTGAATCAACCTGTGG + Intergenic
1151144819 17:72030790-72030812 CTTGCCTGTGAAGCCACAGGAGG - Intergenic
1152272693 17:79334256-79334278 GGTGCCAGTGAAGCCACCTGGGG - Intronic
1152463283 17:80452255-80452277 CTTGCCACTGAGGCTTCCTGAGG - Intergenic
1153104507 18:1511323-1511345 CCTGCCAGTGCACCATCCTGGGG - Intergenic
1155258054 18:24015157-24015179 CTTGCCAGGGAGGAGACCTGAGG - Intronic
1156002043 18:32395883-32395905 CTTCCCAGTTAAGCTACTTGGGG - Intronic
1162379807 19:10324777-10324799 CTTGACAGTGAAGCAGCTTGAGG - Intronic
1163335913 19:16671522-16671544 TTTGACAGTGAAGCAAACTAAGG + Intronic
1163430812 19:17266242-17266264 CTTGCCAGAAAAGCAACAGGAGG + Intronic
1163576046 19:18111225-18111247 CTTCCCAGTTAAGAAAACTGAGG + Intronic
1164733292 19:30521750-30521772 CTAGCCAGAGAAGCCAGCTGGGG + Intronic
1165774199 19:38395355-38395377 CTTGGGAGAGAAGCAAGCTGGGG + Intronic
1167374839 19:49105076-49105098 CTTGGCAGTGACGCATGCTGGGG + Intronic
926942844 2:18156192-18156214 TTTGCCAGTGAGGAAAACTGGGG + Intronic
927499211 2:23571077-23571099 CCTGCCAGAGAAGCCTCCTGAGG - Intronic
927843831 2:26461373-26461395 CTTTACAGAGAAGCAACCTGAGG + Intronic
928561898 2:32497472-32497494 TTTGCCATTGAAGCATCCTGTGG + Intronic
929023117 2:37574025-37574047 CTAGCCAGTTAAGCAGCCTCAGG + Intergenic
930224814 2:48781271-48781293 CCTGCCAGTAAAGAAACCTGAGG + Intergenic
931797482 2:65724907-65724929 CAAGCCAGTGAAGCAAGCTGAGG - Intergenic
934210276 2:89969891-89969913 ATTGACAGGGAAGTAACCTGGGG - Intergenic
936315201 2:111418695-111418717 TTTGCTAGTGAAGCCAGCTGAGG + Intergenic
936466189 2:112753347-112753369 CTTGGCAGTGACACAGCCTGGGG - Intronic
936761361 2:115788456-115788478 CTTGTCAGGGAAGCAACTTTTGG - Intronic
937478192 2:122233771-122233793 TTTCCCAGTGAAGCAGCCAGAGG - Intergenic
941614287 2:167701368-167701390 ATTTCCAGTGCAGCAGCCTGTGG + Intergenic
943940071 2:193981742-193981764 TTTACCACTGAAGCAATCTGGGG - Intergenic
948476740 2:238225459-238225481 CTTGGGAGTGGAGGAACCTGAGG - Exonic
948497608 2:238362506-238362528 CTGGCCTGTGAGGCACCCTGAGG - Intronic
1169187087 20:3627856-3627878 GTTACCAATGAAGCCACCTGGGG - Intronic
1170755791 20:19205918-19205940 CTTGCCAGTGAAACAAACTCGGG + Intergenic
1171272623 20:23828466-23828488 CCTGGCAATGAAGCAACTTGGGG - Intergenic
1172868157 20:38115737-38115759 CTTACCAATGAAGCCATCTGAGG + Intronic
1173583694 20:44165843-44165865 CTTCTCAGTGAAGCCACCCGTGG + Intronic
1175220204 20:57412330-57412352 CTTTCCAGTTGAGCAAACTGAGG + Intergenic
1179426236 21:41280703-41280725 CCAGCCACTGATGCAACCTGAGG - Intronic
1179797422 21:43793481-43793503 CTGGGCAGGGAGGCAACCTGAGG + Intronic
1179936058 21:44603932-44603954 CATCCCAGAGAAGCCACCTGTGG + Intronic
1181625422 22:24119451-24119473 CTTGCCAGGGATGCAAGCAGAGG - Exonic
1181696354 22:24594719-24594741 TTTGCCAGGGAGGAAACCTGTGG - Intronic
1182242809 22:28930553-28930575 TTTGACAGATAAGCAACCTGAGG - Intronic
1182434620 22:30322366-30322388 CTTGCCAGTAAATGATCCTGTGG - Intronic
1182567343 22:31210261-31210283 ATGGCCAGTGAAACAAACTGTGG + Intergenic
1183741062 22:39668932-39668954 CTTGTCAGTGCAGCTTCCTGAGG + Intronic
949439357 3:4064007-4064029 CTTGACAGAGAAGGAAACTGAGG + Intronic
949795922 3:7850995-7851017 CTCGGCAGAGAGGCAACCTGGGG + Intergenic
950889284 3:16388531-16388553 CTTAACAGTGAAGAAAACTGAGG + Intronic
954692426 3:52402713-52402735 CTTGCCAGAGCAGCCACCAGTGG + Intronic
957289875 3:78266381-78266403 CTTCCCAGAGAAGCAAAGTGAGG - Intergenic
959133716 3:102390761-102390783 GTGGCCAGTTAAGCAACGTGTGG - Intronic
961312293 3:126010717-126010739 CTTGTCAGTGAAGCCATGTGGGG + Intronic
964474552 3:157086977-157086999 CAGGCCAGTGAAGGAAACTGGGG + Intergenic
966418265 3:179711663-179711685 CTTTCCAGTGGGACAACCTGTGG - Intronic
967335880 3:188344163-188344185 CTTGCTAATGAATCACCCTGTGG - Intronic
967502624 3:190217494-190217516 CTTCCCAGTGATGCAATGTGGGG + Intergenic
969563452 4:7963834-7963856 CTAGACAGTGCAGCACCCTGAGG - Intergenic
969959646 4:10930722-10930744 CTTGCCAGGGAAGTGACCTTGGG + Intergenic
972567577 4:40283341-40283363 CTTGGGAGGGAAGCAGCCTGAGG - Intergenic
975147181 4:70980986-70981008 CTTTCCAGTGCAGAATCCTGAGG + Intronic
975156551 4:71079184-71079206 CTGGCCAGAGAAGCACCCAGAGG - Intergenic
976724396 4:88201525-88201547 TTTGCCAGTGAATCTATCTGGGG - Intronic
979814484 4:125083617-125083639 GTTGGAAGTGAAGCAACATGTGG + Intergenic
986444836 5:7812160-7812182 CTTACCAGTGAAGGGAACTGGGG - Intronic
994173935 5:96690032-96690054 CTGGTCAGTGCAGCAACCTCAGG + Intronic
994502130 5:100592415-100592437 ATTGCCAGTGCAGAAACCAGAGG + Intergenic
997835314 5:137187277-137187299 GTTTCCAGTGAATCACCCTGGGG - Intronic
997856153 5:137374478-137374500 CCTGCTAGTGCAGGAACCTGTGG - Intronic
1003463994 6:6360049-6360071 CTTGCCAGAGAATCAAAGTGAGG + Intergenic
1006192355 6:32217363-32217385 CTTCCCAGAGAAGACACCTGGGG + Intronic
1006434933 6:34021111-34021133 CCTGCCAGGGAAGCCAGCTGAGG + Intronic
1006454298 6:34123150-34123172 CTTGCCAGTGAAGCAACCTGTGG - Intronic
1007702741 6:43774052-43774074 CTCGACAGTGAAGCATTCTGGGG + Intronic
1010510858 6:76717472-76717494 CTTTCCAGTGAAGCCAACTCTGG + Intergenic
1011345383 6:86364214-86364236 CCTTCCAGTGAAGCAAATTGTGG - Intergenic
1011439728 6:87374703-87374725 TTTGTAAGTGAAGAAACCTGAGG - Intronic
1015198313 6:130549137-130549159 CTTGGCAGTTATGCAACATGAGG + Intergenic
1016157582 6:140831386-140831408 CTTGCCTCTGCAGCAACTTGTGG + Intergenic
1019063781 6:169277975-169277997 CTTTACAGAGAAGCCACCTGAGG + Intergenic
1019710698 7:2516983-2517005 GTTGCCAGTGAAGCCTCTTGGGG - Intronic
1021034671 7:15783956-15783978 CTTGCCAGGGGAACAACCAGTGG - Intergenic
1024851316 7:53720484-53720506 TAGGCCAGTGAAGCAGCCTGAGG - Intergenic
1028638052 7:93013284-93013306 TGTGCAAGTGAAGCACCCTGAGG - Intergenic
1029456237 7:100673918-100673940 TTTGCCAGCGAAGGTACCTGTGG - Exonic
1031388360 7:121181216-121181238 CTTGCATGTCAAGCAAACTGGGG - Intronic
1031871050 7:127090704-127090726 CATGCCAGTGCCGCAACCGGAGG - Intronic
1033925850 7:146459378-146459400 CTTGCAATTGGAGCTACCTGAGG - Intronic
1036137189 8:6173235-6173257 CTTTCCTGTGAAGCCGCCTGCGG - Intergenic
1038382325 8:27107481-27107503 CTTGCCAGAGAAACAAGCTGTGG - Intergenic
1039699970 8:39952155-39952177 CTTATCTGTGAAGCAACCTGGGG - Intronic
1041639725 8:60184224-60184246 CTCCCCAGTGAAGAAAACTGTGG + Intergenic
1042530704 8:69811865-69811887 CTGGCCAGTGGTGCAAACTGGGG - Intronic
1046354380 8:113060515-113060537 GTTGCCAGTGAAGTAACCTCAGG - Intronic
1048622426 8:136148469-136148491 CTTGCCAGTGAATTAACCACTGG - Intergenic
1049566865 8:143344782-143344804 CTTGCCAGTTAATCACCCTTAGG - Intronic
1051096941 9:13477252-13477274 CATGCCAGCAAAGCAACCTGGGG + Intergenic
1051755759 9:20398472-20398494 CTTGACAATTATGCAACCTGAGG + Intronic
1054088467 9:60770444-60770466 CTTGGCGGTGGAGCACCCTGAGG + Intergenic
1054243739 9:62641684-62641706 CTTGGCGGTGGAGCACCCTGAGG + Intergenic
1054557863 9:66676229-66676251 CTTGGCGGTGGAGCACCCTGAGG + Intergenic
1054976507 9:71152790-71152812 ATTCCCAGTTAAGCAACTTGTGG + Intronic
1059001907 9:110357214-110357236 CTTTCCATTTAAGAAACCTGAGG - Intergenic
1060878816 9:127103352-127103374 CTTGTCAGTGAAGCAATGTGGGG + Intronic
1061408902 9:130407718-130407740 CTTGAGAGAGAAGCCACCTGGGG - Intronic
1062246421 9:135569628-135569650 TTTACCAGTGAAGCCAACTGGGG + Intergenic
1062630466 9:137460990-137461012 CTTGTCAGCCAAGCACCCTGAGG + Intronic
1185668103 X:1784380-1784402 CTTGCAAGGGAAGCAAACTTTGG + Intergenic
1186007852 X:5094243-5094265 CGTGCCAGTGAAACAGCCTCAGG + Intergenic
1187638610 X:21261876-21261898 CTTTCCATTAAAGCAAACTGTGG + Intergenic
1187800818 X:23060669-23060691 CTCGCCAATGAAGCACCCTCAGG + Intergenic
1187816151 X:23234369-23234391 CTTGCCTGTGACACAACCTCAGG - Intergenic
1194567051 X:95502281-95502303 GTTTCCAGTGAAGCCATCTGAGG - Intergenic
1195431288 X:104792331-104792353 CTAGACAGTGAAGCGATCTGGGG - Intronic
1196629320 X:117917984-117918006 CATGCCAGTGACACAACCAGAGG + Intronic
1198370348 X:135983672-135983694 CTGGTCAGGGAAGCAATCTGTGG + Intergenic
1199524314 X:148775446-148775468 TTTGCCAGTGAAGCAAAGTGAGG + Intronic
1200320859 X:155187669-155187691 CTTGCCAGTGAAGACACTAGAGG - Intergenic
1200836975 Y:7741420-7741442 CTTAACAGTGAAGAAAACTGAGG + Intergenic