ID: 1006455495

View in Genome Browser
Species Human (GRCh38)
Location 6:34129660-34129682
Sequence GACTCAGCTGTCTCTTGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 142}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006455490_1006455495 18 Left 1006455490 6:34129619-34129641 CCTTCTGGTCCGCAACAGAGGCC 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1006455495 6:34129660-34129682 GACTCAGCTGTCTCTTGAGCAGG 0: 1
1: 0
2: 1
3: 13
4: 142
1006455488_1006455495 29 Left 1006455488 6:34129608-34129630 CCAGAGTCAGGCCTTCTGGTCCG 0: 1
1: 0
2: 1
3: 5
4: 91
Right 1006455495 6:34129660-34129682 GACTCAGCTGTCTCTTGAGCAGG 0: 1
1: 0
2: 1
3: 13
4: 142
1006455491_1006455495 9 Left 1006455491 6:34129628-34129650 CCGCAACAGAGGCCTGTTCAAGT 0: 1
1: 0
2: 1
3: 12
4: 100
Right 1006455495 6:34129660-34129682 GACTCAGCTGTCTCTTGAGCAGG 0: 1
1: 0
2: 1
3: 13
4: 142
1006455487_1006455495 30 Left 1006455487 6:34129607-34129629 CCCAGAGTCAGGCCTTCTGGTCC 0: 1
1: 0
2: 1
3: 14
4: 183
Right 1006455495 6:34129660-34129682 GACTCAGCTGTCTCTTGAGCAGG 0: 1
1: 0
2: 1
3: 13
4: 142
1006455492_1006455495 -3 Left 1006455492 6:34129640-34129662 CCTGTTCAAGTCCCACTTCTGAC 0: 1
1: 0
2: 2
3: 24
4: 209
Right 1006455495 6:34129660-34129682 GACTCAGCTGTCTCTTGAGCAGG 0: 1
1: 0
2: 1
3: 13
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006455495 Original CRISPR GACTCAGCTGTCTCTTGAGC AGG Intronic
901022611 1:6262729-6262751 GCCTCAGCTGGCTCTAGGGCAGG + Intergenic
904977671 1:34470476-34470498 GACTTAGCTGTGTCTGGGGCTGG - Intergenic
906489281 1:46255438-46255460 GACTCACCAGTCTCTATAGCAGG - Intronic
906807117 1:48789780-48789802 GTCTCAGCTGTCTCCTGAGCTGG - Intronic
910104998 1:83622462-83622484 GACTCATCATTCTCTTGATCTGG - Intergenic
911238396 1:95437249-95437271 GACTAAGCTGATTCTTGAGGAGG - Intergenic
911948257 1:104138406-104138428 AACTGAGCAGTCTCTTGAGCGGG + Intergenic
913099381 1:115549285-115549307 GCATCAGCTGGCACTTGAGCTGG + Intergenic
913700698 1:121371436-121371458 ACCTCAGTTTTCTCTTGAGCTGG + Intronic
914041247 1:144051898-144051920 ACCTCAGTTTTCTCTTGAGCTGG + Intergenic
914136839 1:144908588-144908610 ACCTCAGTTTTCTCTTGAGCTGG - Intronic
919550391 1:198978243-198978265 AACTCATCTGTCTCTTGCACTGG - Intergenic
920488115 1:206390169-206390191 ACCTCAGTTTTCTCTTGAGCTGG + Intronic
922895127 1:229093980-229094002 GATTCAGCTGTCTCGTGTGGGGG + Intergenic
1065589119 10:27248205-27248227 CACTGAGCTGACTATTGAGCCGG - Intergenic
1069444773 10:68463015-68463037 GCCTCAGCCTTCTCTTTAGCTGG - Intronic
1072132315 10:92507282-92507304 AAATCAGCAGTTTCTTGAGCTGG - Intronic
1074799381 10:116983976-116983998 TACTCAGCTGCCTGTTGGGCTGG - Intronic
1075927048 10:126260049-126260071 GACCCAGGTGTCACTTGAGGTGG - Intronic
1076943517 10:133626489-133626511 TACTGAGCTGTGTCTTTAGCAGG - Intronic
1077285787 11:1764653-1764675 TGCACAGCTGTCTCTTGAGGGGG + Intergenic
1079125893 11:17718703-17718725 GGCTGAGCTGCCTCTTCAGCTGG - Intergenic
1079398281 11:20084768-20084790 AACTCAGTTGTCTCCTGACCAGG + Intronic
1082784927 11:57311526-57311548 GACTCAACTGGCTCCTGGGCGGG - Intronic
1085281693 11:75335166-75335188 GCCTCATCTGTCTGTTGGGCTGG - Intronic
1089774895 11:120829185-120829207 GTCTCAGCTATCTCCTGAGCAGG - Intronic
1091388697 12:111925-111947 AAATCGGGTGTCTCTTGAGCAGG + Intronic
1093200057 12:16175819-16175841 GCCCCTGCTGTCTCTTAAGCAGG - Intergenic
1094772937 12:33686465-33686487 GCCTCAGCTATCTCTTTAGTAGG - Intergenic
1097133720 12:56834429-56834451 AACTGAGCAGTCTCTTGAGGGGG - Intergenic
1097761303 12:63468109-63468131 GGCTAAGCCATCTCTTGAGCTGG + Intergenic
1098593508 12:72242567-72242589 GACTCTCCTGCTTCTTGAGCGGG + Intronic
1099429144 12:82560342-82560364 GAATTAGCTGTCTCATCAGCAGG + Intergenic
1101796133 12:107975863-107975885 GACTCAACTGACTCTGGAGGTGG - Intergenic
1103426755 12:120842553-120842575 GACTTCCCTGTCTCTAGAGCTGG - Intronic
1103949412 12:124542920-124542942 GCCTCAGCTGTCCCTGGAGAAGG - Intronic
1104313898 12:127679423-127679445 CTCTCAGCTATCTCTTGGGCAGG + Intergenic
1109627206 13:64991657-64991679 GGCTCAGGTGTTTCTTGAGGAGG - Intergenic
1110709143 13:78630693-78630715 GACACAGCTGTCTATGAAGCAGG + Intronic
1113705820 13:112432570-112432592 GACACACCTGTCCCTTGAGCAGG - Intronic
1117311220 14:54525136-54525158 GTCACATCTGGCTCTTGAGCAGG + Intronic
1118005729 14:61562862-61562884 GACTTAGCTCTCTCTTAAGTGGG - Intronic
1119346790 14:73931897-73931919 GACTCAGCTGTCTTTTCACATGG + Exonic
1120746893 14:88160240-88160262 ATTTCGGCTGTCTCTTGAGCCGG + Intergenic
1121721796 14:96114515-96114537 AACTGAGCAATCTCTTGAGCGGG - Intergenic
1122814397 14:104305322-104305344 GACTCTGCTGACTGCTGAGCTGG - Intergenic
1122959832 14:105089392-105089414 GGCTCTGCTGTCACCTGAGCTGG - Intergenic
1123006340 14:105325586-105325608 GAGCCAGGTGTGTCTTGAGCTGG + Intronic
1123061659 14:105597306-105597328 GACTCAGCTGTGTCCTGGGCTGG + Intergenic
1123086397 14:105719036-105719058 GACTCAGCTGTGTCCTGGGCTGG + Intergenic
1124134875 15:27025963-27025985 GGCTCAGCTGTCTCATTATCAGG + Intronic
1130907623 15:88251648-88251670 AACTCAGCTGGCTCTTGGGTGGG - Intronic
1131458164 15:92599232-92599254 GACTCTGCAGTGACTTGAGCCGG - Intergenic
1132110243 15:99097463-99097485 GACCCCGCTGTGTCTTGGGCAGG - Intergenic
1134249414 16:12563885-12563907 GCCTCTGCCGTCTCTGGAGCAGG + Intronic
1138037087 16:53619075-53619097 GACACGGGTGTCTCTTCAGCAGG + Exonic
1138333099 16:56230977-56230999 GCCTCAGCTGTCTCCTGACAGGG - Intronic
1138431084 16:56969662-56969684 TACTCAGCTGTGTGTTGATCTGG - Exonic
1141792063 16:86243689-86243711 GACTCAGCTCACTGTTCAGCAGG - Intergenic
1146344294 17:32047834-32047856 CACTCAGCTGACTATTGAGTCGG + Exonic
1147243717 17:39107374-39107396 GACCCAGCTGTCTCTGCAGCTGG + Intronic
1147559833 17:41501878-41501900 GATGCTGCTGTCCCTTGAGCTGG - Intronic
1148170470 17:45515284-45515306 CACTGAGCTGACTGTTGAGCCGG - Intergenic
1148170947 17:45519277-45519299 CACTGAGCTGACTGTTGAGCCGG - Intergenic
1148365073 17:47049275-47049297 CACTGAGCTGACTGTTGAGCCGG + Intergenic
1148601015 17:48894202-48894224 GAGACAGCTGTCTCTGGGGCAGG + Intronic
1152561952 17:81083074-81083096 GACTCAGCTGTGCTTTGAGGAGG + Intronic
1152930186 17:83105311-83105333 GACTCAGCAGCCTCTTCACCCGG - Intergenic
1157141899 18:45117112-45117134 GATGCAGCTGTTTCTTGAACCGG - Intergenic
1159504419 18:69316394-69316416 GAATCAGCTGGCTTTTGAGCTGG - Intergenic
1160794524 19:938757-938779 GACCCAGCGGTCTCTGGGGCTGG - Intronic
1161595689 19:5150040-5150062 GAGACAGATGTCTTTTGAGCTGG + Intronic
1162918997 19:13889474-13889496 AACTCGGCTTCCTCTTGAGCAGG + Exonic
1163518837 19:17780105-17780127 CACTCAGCTCTCCCTTGAACGGG - Intronic
1163729679 19:18941607-18941629 GAGGCAGCTGTCTCCTGAGAAGG - Intergenic
1164444784 19:28307859-28307881 GATTCAGCACTCTCTGGAGCAGG - Intergenic
1165471897 19:36008859-36008881 GACTCTTCTGTCACCTGAGCTGG - Intergenic
1166041589 19:40206039-40206061 GGCTCAGCTGGCACATGAGCAGG - Exonic
1168282814 19:55314607-55314629 GACTCAGTAGTCTCTTGGGTGGG - Intronic
925437895 2:3857092-3857114 GAGGCAGCTGTCTCAGGAGCAGG - Intergenic
927706415 2:25299136-25299158 GAACCAGCTGTCTCTGGTGCTGG + Intronic
933098429 2:78218375-78218397 GGCTCAGCTGTCTCTTGTTGAGG + Intergenic
934035062 2:88082376-88082398 GACACAGCAGTGTGTTGAGCTGG + Intronic
938079227 2:128360464-128360486 GCCTCAGCTGTCTCACCAGCTGG + Intergenic
938080446 2:128367278-128367300 GACACAGCTGTCTCATTTGCAGG - Intergenic
938104506 2:128520820-128520842 GCCTCAGCTGTCACCTGAGGAGG + Intergenic
944281450 2:197902891-197902913 GAATCAGCACTCTCCTGAGCTGG - Intronic
944325982 2:198404381-198404403 GACTCAGTTCTCTCATGAGATGG + Intronic
946869306 2:224071586-224071608 CCCTCAGCTGTCTCTTCTGCTGG + Intergenic
948296457 2:236864263-236864285 GGCACAGCTGTCTTGTGAGCTGG + Intergenic
1168810544 20:701758-701780 GGCTCAGCTGCCTCTGGAGGGGG + Intergenic
1169551736 20:6708125-6708147 CACTCAGCTGTCGGCTGAGCTGG - Intergenic
1170769435 20:19319199-19319221 GACTCTACTGTCCCATGAGCAGG + Intronic
1171776470 20:29372904-29372926 GACTCAGGTGACTCTTGAAGTGG - Intergenic
1173614961 20:44396516-44396538 GAATCTGCTGCCTCTTGAGCTGG + Intronic
1175220841 20:57415468-57415490 GGCTCAGCTGTCTGGTGGGCCGG - Intergenic
1176046831 20:63097182-63097204 GCCTCAGCTGTCCCTTAAGCAGG - Intergenic
1179241818 21:39599451-39599473 GGCTCAGCTGGGCCTTGAGCTGG + Intronic
1179500040 21:41802900-41802922 GCCTGAGCTGACTCTGGAGCAGG - Exonic
1179727014 21:43346447-43346469 GCCTCAGCAGGCCCTTGAGCGGG - Intergenic
1179790206 21:43752034-43752056 GAGTCAGCTGACCCTGGAGCAGG + Intronic
1180207708 21:46272256-46272278 CACTCACCTGTCTCATGAGGAGG + Intronic
1181366403 22:22380410-22380432 GACACAGGTGTCACTTGAGCTGG + Intergenic
1181688522 22:24545193-24545215 GACTCAGCTGTGGCTGAAGCTGG - Intronic
1181846415 22:25712893-25712915 GACTCAGCTCTCACGGGAGCAGG - Intronic
949541668 3:5037306-5037328 GACTCACCTGACTCTAAAGCTGG - Intergenic
955329147 3:58032535-58032557 GATTCAGCAGTCCCTTGAGATGG - Intronic
955430139 3:58835017-58835039 AACTCAGCAGTCTCTTAAGAGGG - Intronic
957088619 3:75706749-75706771 GACTCAGGTGACTCTTGAAGTGG + Intergenic
960808875 3:121609920-121609942 GACTCAGGTGACTCTTGAAGTGG - Intronic
975586766 4:75957739-75957761 GGCTGAGCTCTCACTTGAGCTGG - Intronic
978040718 4:104057787-104057809 ACCTCAGCTGTCTCTGGAGGTGG - Intergenic
979450479 4:120864957-120864979 GACACAGCTGTGTCTGTAGCAGG - Intronic
985446873 4:190026951-190026973 TACTGAGCTGTGTCTTTAGCAGG - Intronic
989100164 5:37815626-37815648 TACACAGCAGTCTCTGGAGCCGG + Intronic
994259776 5:97643520-97643542 GACCCAGCTGTCTCATTACCAGG - Intergenic
999464347 5:151787952-151787974 GTCTCAGCTGTCTCCCGGGCTGG + Intronic
1003245778 6:4380915-4380937 GTCTCAGCTCTCTGTTGAGCCGG - Intergenic
1006455495 6:34129660-34129682 GACTCAGCTGTCTCTTGAGCAGG + Intronic
1006723059 6:36172685-36172707 GGCACAGCTGGCTCTTCAGCAGG - Intergenic
1009761173 6:68008711-68008733 AACTCAGATGTCTCTTGCTCAGG + Intergenic
1013167623 6:107607899-107607921 AACTCACCTCTCTCTAGAGCTGG - Intronic
1019018191 6:168895892-168895914 GACTCGGCGGTCTCTTGTGCAGG + Intergenic
1019181100 6:170187679-170187701 CACTCAGCTGTTTCTTATGCAGG - Intergenic
1019430089 7:995078-995100 GTCTCAGCTGGCGCTTGTGCGGG - Intergenic
1020232015 7:6326494-6326516 GCCTCAGCTGTCTGTGTAGCTGG + Intergenic
1021593676 7:22292226-22292248 TTCTCAGCTGTCCCATGAGCTGG - Intronic
1022621570 7:31989766-31989788 GTCTCAGCTTTCTCCTGGGCAGG + Intronic
1023676503 7:42635588-42635610 GACTCAGCTGAAACTTGAACTGG + Intergenic
1024605527 7:51019645-51019667 GAGTCAGCTGCCTCTTCTGCAGG - Intronic
1025265378 7:57452064-57452086 TCCTCAGCTGTGTCTTAAGCAGG + Intronic
1025741711 7:64203139-64203161 GTCTCTCCTGTCTCTTGGGCTGG + Intronic
1029960616 7:104686234-104686256 TACTCAGCTGTTTCTTTAGCTGG - Intronic
1033987974 7:147249948-147249970 GACTGAGCTGTCTTTTAATCTGG - Intronic
1034438907 7:151076772-151076794 GCCTCAGGTAGCTCTTGAGCTGG + Exonic
1036885806 8:12552144-12552166 GACTCACCTGCCTCCAGAGCTGG + Intergenic
1037965171 8:23128348-23128370 GGCTCGGCTGCCTCATGAGCGGG - Intergenic
1038001883 8:23399049-23399071 GACTCAGCTGTGTGTTGCTCTGG + Intronic
1041375501 8:57206866-57206888 TACCCAGATGTCTCTTGGGCAGG - Intergenic
1041376264 8:57211245-57211267 TACCCAGATGTCTCTTGGGCAGG - Intergenic
1041392725 8:57361035-57361057 GAGTCAGGTGTGTCTTAAGCAGG - Intergenic
1043734753 8:83729434-83729456 GACTGAGCAATCTCTTGAGAAGG - Intergenic
1043766538 8:84141000-84141022 TTCCCTGCTGTCTCTTGAGCTGG - Intergenic
1044659035 8:94577796-94577818 AACTGAGCAATCTCTTGAGCGGG - Intergenic
1047447250 8:124930444-124930466 GGCTCAGCTCACTCCTGAGCTGG - Intergenic
1049205135 8:141360121-141360143 GGCTCTGCGGTCTCTGGAGCTGG + Intronic
1049223100 8:141436835-141436857 GCCGCAGCTGTCCCTGGAGCAGG + Intergenic
1049330316 8:142046974-142046996 GGCTCAGCTGTGTCCAGAGCTGG - Intergenic
1051346418 9:16154889-16154911 GGCCCAGCTGTCTCTCGGGCGGG + Intergenic
1052270269 9:26621111-26621133 GACTCAGCTATTTTTTGAGTTGG + Intergenic
1059422146 9:114198876-114198898 GCCTCAGCTGCCTCATGAGGTGG + Intronic
1061594876 9:131622282-131622304 GTCTCAGCTACCTCCTGAGCAGG + Intronic
1061765154 9:132877322-132877344 GGCTCAGCTGTCTAGTGTGCAGG + Intronic
1188537661 X:31215335-31215357 GACTCAGATGCCTCTTGGGGTGG + Intronic
1190703610 X:53006663-53006685 GACACAGCTGGATCTAGAGCTGG + Intergenic
1193486370 X:82089243-82089265 AACTAAGCAGTCTCTTGAGAGGG + Intergenic
1198030180 X:132747094-132747116 GACTCATCTGTCTCTTTCTCTGG - Intronic