ID: 1006456735

View in Genome Browser
Species Human (GRCh38)
Location 6:34136284-34136306
Sequence GCTCCTCTGTGCTGGCCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006456726_1006456735 19 Left 1006456726 6:34136242-34136264 CCAGGGGCACAGAGCTTGTGCAG 0: 1
1: 0
2: 2
3: 38
4: 301
Right 1006456735 6:34136284-34136306 GCTCCTCTGTGCTGGCCCAGAGG No data
1006456730_1006456735 -9 Left 1006456730 6:34136270-34136292 CCGTGCCCCTGGCTGCTCCTCTG 0: 1
1: 1
2: 18
3: 88
4: 796
Right 1006456735 6:34136284-34136306 GCTCCTCTGTGCTGGCCCAGAGG No data
1006456729_1006456735 -8 Left 1006456729 6:34136269-34136291 CCCGTGCCCCTGGCTGCTCCTCT 0: 1
1: 2
2: 8
3: 86
4: 716
Right 1006456735 6:34136284-34136306 GCTCCTCTGTGCTGGCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006456735 Original CRISPR GCTCCTCTGTGCTGGCCCAG AGG Intronic