ID: 1006457492 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:34140298-34140320 |
| Sequence | CAACGTGACCAGGGGGCAGT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1006457481_1006457492 | 30 | Left | 1006457481 | 6:34140245-34140267 | CCCTGAGGTGGGCACAGGCTTGG | 0: 1 1: 2 2: 5 3: 69 4: 477 |
||
| Right | 1006457492 | 6:34140298-34140320 | CAACGTGACCAGGGGGCAGTGGG | No data | ||||
| 1006457483_1006457492 | 29 | Left | 1006457483 | 6:34140246-34140268 | CCTGAGGTGGGCACAGGCTTGGC | 0: 1 1: 1 2: 4 3: 46 4: 407 |
||
| Right | 1006457492 | 6:34140298-34140320 | CAACGTGACCAGGGGGCAGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1006457492 | Original CRISPR | CAACGTGACCAGGGGGCAGT GGG | Intronic | ||
| No off target data available for this crispr | |||||