ID: 1006457492

View in Genome Browser
Species Human (GRCh38)
Location 6:34140298-34140320
Sequence CAACGTGACCAGGGGGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006457481_1006457492 30 Left 1006457481 6:34140245-34140267 CCCTGAGGTGGGCACAGGCTTGG 0: 1
1: 2
2: 5
3: 69
4: 477
Right 1006457492 6:34140298-34140320 CAACGTGACCAGGGGGCAGTGGG No data
1006457483_1006457492 29 Left 1006457483 6:34140246-34140268 CCTGAGGTGGGCACAGGCTTGGC 0: 1
1: 1
2: 4
3: 46
4: 407
Right 1006457492 6:34140298-34140320 CAACGTGACCAGGGGGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006457492 Original CRISPR CAACGTGACCAGGGGGCAGT GGG Intronic
No off target data available for this crispr