ID: 1006457575

View in Genome Browser
Species Human (GRCh38)
Location 6:34140724-34140746
Sequence TTTCCAGCACAAGACCCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 199}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006457562_1006457575 22 Left 1006457562 6:34140679-34140701 CCCCCAGGCCTCTCCTCCCCATC 0: 1
1: 2
2: 16
3: 134
4: 967
Right 1006457575 6:34140724-34140746 TTTCCAGCACAAGACCCAAGTGG 0: 1
1: 0
2: 0
3: 9
4: 199
1006457565_1006457575 19 Left 1006457565 6:34140682-34140704 CCAGGCCTCTCCTCCCCATCCCT 0: 1
1: 1
2: 16
3: 259
4: 2424
Right 1006457575 6:34140724-34140746 TTTCCAGCACAAGACCCAAGTGG 0: 1
1: 0
2: 0
3: 9
4: 199
1006457564_1006457575 20 Left 1006457564 6:34140681-34140703 CCCAGGCCTCTCCTCCCCATCCC 0: 1
1: 1
2: 17
3: 148
4: 1295
Right 1006457575 6:34140724-34140746 TTTCCAGCACAAGACCCAAGTGG 0: 1
1: 0
2: 0
3: 9
4: 199
1006457568_1006457575 6 Left 1006457568 6:34140695-34140717 CCCCATCCCTACATGCCGCCATC 0: 1
1: 0
2: 0
3: 18
4: 166
Right 1006457575 6:34140724-34140746 TTTCCAGCACAAGACCCAAGTGG 0: 1
1: 0
2: 0
3: 9
4: 199
1006457569_1006457575 5 Left 1006457569 6:34140696-34140718 CCCATCCCTACATGCCGCCATCT 0: 1
1: 0
2: 0
3: 8
4: 138
Right 1006457575 6:34140724-34140746 TTTCCAGCACAAGACCCAAGTGG 0: 1
1: 0
2: 0
3: 9
4: 199
1006457563_1006457575 21 Left 1006457563 6:34140680-34140702 CCCCAGGCCTCTCCTCCCCATCC 0: 1
1: 0
2: 29
3: 141
4: 1171
Right 1006457575 6:34140724-34140746 TTTCCAGCACAAGACCCAAGTGG 0: 1
1: 0
2: 0
3: 9
4: 199
1006457567_1006457575 9 Left 1006457567 6:34140692-34140714 CCTCCCCATCCCTACATGCCGCC 0: 1
1: 0
2: 2
3: 24
4: 330
Right 1006457575 6:34140724-34140746 TTTCCAGCACAAGACCCAAGTGG 0: 1
1: 0
2: 0
3: 9
4: 199
1006457572_1006457575 -1 Left 1006457572 6:34140702-34140724 CCTACATGCCGCCATCTCTAGTT 0: 1
1: 0
2: 2
3: 5
4: 84
Right 1006457575 6:34140724-34140746 TTTCCAGCACAAGACCCAAGTGG 0: 1
1: 0
2: 0
3: 9
4: 199
1006457571_1006457575 0 Left 1006457571 6:34140701-34140723 CCCTACATGCCGCCATCTCTAGT 0: 1
1: 1
2: 0
3: 3
4: 66
Right 1006457575 6:34140724-34140746 TTTCCAGCACAAGACCCAAGTGG 0: 1
1: 0
2: 0
3: 9
4: 199
1006457570_1006457575 4 Left 1006457570 6:34140697-34140719 CCATCCCTACATGCCGCCATCTC 0: 1
1: 0
2: 0
3: 17
4: 328
Right 1006457575 6:34140724-34140746 TTTCCAGCACAAGACCCAAGTGG 0: 1
1: 0
2: 0
3: 9
4: 199
1006457566_1006457575 14 Left 1006457566 6:34140687-34140709 CCTCTCCTCCCCATCCCTACATG 0: 1
1: 0
2: 10
3: 66
4: 707
Right 1006457575 6:34140724-34140746 TTTCCAGCACAAGACCCAAGTGG 0: 1
1: 0
2: 0
3: 9
4: 199
1006457573_1006457575 -9 Left 1006457573 6:34140710-34140732 CCGCCATCTCTAGTTTTCCAGCA 0: 1
1: 0
2: 0
3: 26
4: 499
Right 1006457575 6:34140724-34140746 TTTCCAGCACAAGACCCAAGTGG 0: 1
1: 0
2: 0
3: 9
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006457575 Original CRISPR TTTCCAGCACAAGACCCAAG TGG Intronic
900730041 1:4252004-4252026 TTTCCAGTCAAAGACTCAAGGGG + Intergenic
903735378 1:25526894-25526916 ACTCCAGCACAAGACACAGGTGG + Intergenic
905776964 1:40674516-40674538 TTTCCAGCACATGAACCTTGGGG - Intergenic
905976821 1:42181632-42181654 TTGCTAGCACAAGTGCCAAGTGG + Intronic
909528988 1:76659904-76659926 TCTCAAGCACAAGTCCCTAGGGG + Intergenic
910179789 1:84469692-84469714 TTCCAATCACAAGAGCCAAGAGG - Intergenic
911158225 1:94656932-94656954 TTTCCAGCTGAGGCCCCAAGAGG + Intergenic
916492841 1:165316755-165316777 TTTACAGCACAAGACAAAAATGG + Intronic
920565831 1:206972300-206972322 TATCCAGCACAAAGCCCCAGGGG + Intergenic
920780808 1:208989285-208989307 TTTGTAGCTCATGACCCAAGAGG - Intergenic
924249146 1:242113889-242113911 TCTCCAGCACAAGCACCAAAAGG - Exonic
924702884 1:246472124-246472146 ACTCCAGCACAAGCCACAAGGGG + Intronic
1063185009 10:3642698-3642720 CTTCCTGCACAAGGCCCAATAGG - Intergenic
1064599476 10:16978635-16978657 TTTCCTACACAAGATCCAACTGG - Intronic
1065686723 10:28293019-28293041 TTTCCTACACAAGACCCAGAAGG + Intronic
1066458376 10:35591609-35591631 TATTCAGCCCAAGACTCAAGAGG - Intergenic
1068880952 10:62048258-62048280 TGCCCAGCACAACACCCAAAAGG - Intronic
1069632850 10:69907944-69907966 TTTCCAACACAAGAGCTATGGGG + Intronic
1071297189 10:84230319-84230341 TTTACAGAAGAAGACCAAAGAGG - Intergenic
1071829532 10:89357925-89357947 TTACCAGCACAAAACCAAACAGG - Intronic
1079114547 11:17632878-17632900 TTTGAAGAACACGACCCAAGAGG - Intronic
1079895158 11:26110157-26110179 TTTCATACACAACACCCAAGAGG + Intergenic
1080425733 11:32152468-32152490 TTTCCAGAACAATCCCCCAGAGG - Intergenic
1080739101 11:35047319-35047341 TTTCCAGCTCAAGAACCATGGGG + Intergenic
1082600265 11:55141364-55141386 TTTTCACCATAAGACTCAAGGGG + Intergenic
1082897029 11:58203035-58203057 TTTCCAAGACAAGAGCTAAGTGG + Intergenic
1082898256 11:58215869-58215891 TTTCCAAGACAAGAGCTAAGTGG - Intergenic
1087238337 11:95746993-95747015 TTTTCAGCAACAGACTCAAGTGG + Intergenic
1088092752 11:106062495-106062517 TGGCAAGCATAAGACCCAAGAGG + Intronic
1088139025 11:106593175-106593197 TTTGCAGCACAAGAGGCAATGGG + Intergenic
1089072935 11:115715394-115715416 TATCCAGGAGATGACCCAAGGGG - Intergenic
1091311070 11:134575693-134575715 TTTCCGGCACAAGAGACAAAAGG + Intergenic
1093559447 12:20520872-20520894 TTTGCAGCATGAGTCCCAAGTGG - Intronic
1096933549 12:55242716-55242738 TTTCCAGCTGAAGTCCCAATGGG - Intergenic
1098898119 12:76085045-76085067 TTCCCAGCACAACGCCGAAGGGG - Intergenic
1103592811 12:122004288-122004310 TTATCAGCAAAACACCCAAGTGG + Intergenic
1103731339 12:123029621-123029643 CATACACCACAAGACCCAAGGGG - Intronic
1104095103 12:125550022-125550044 TTTCCAGCAGAGGACGCTAGAGG + Intronic
1109481369 13:62959450-62959472 TTTCCAGCACTAGACCTTGGTGG + Intergenic
1112069659 13:95835285-95835307 ATTCCAGCAGCAGACCTAAGTGG - Intronic
1112673497 13:101670029-101670051 TTTCCAGCATCAGACCACAGTGG - Intronic
1115416836 14:33145162-33145184 TTTTCAATACAAGGCCCAAGGGG - Intronic
1115718207 14:36129143-36129165 TTTCCAGTACAGGATCCAAAAGG - Intergenic
1117830689 14:59746679-59746701 TTTCCAGTAACAGACCCCAGAGG + Intronic
1119470740 14:74896944-74896966 TGATCAGCACAAGACCCAAAGGG - Intronic
1120931307 14:89851277-89851299 TTTTCTGAACAAAACCCAAGTGG - Intronic
1121553991 14:94822591-94822613 TTCCCTGAACAAGACCCATGAGG + Intergenic
1122093998 14:99358019-99358041 TTTCCTGCACCAGAGCCAACTGG + Intergenic
1123226207 15:17034746-17034768 TTTCCACCATAGGACCCAAAAGG - Intergenic
1125310783 15:38376210-38376232 TATCCAGCATCACACCCAAGGGG - Intergenic
1126404547 15:48310396-48310418 TTTTAAACACAAAACCCAAGTGG + Intergenic
1126777786 15:52113922-52113944 GTTGGATCACAAGACCCAAGTGG - Intergenic
1126779639 15:52128357-52128379 TTTGCAGCAGAAGACGGAAGAGG + Intronic
1130696956 15:86140484-86140506 TTTCCAGCACCTGGCACAAGGGG - Intergenic
1132295079 15:100728806-100728828 TTCCCAGCACAAGCCCTACGTGG + Intergenic
1136916406 16:34204365-34204387 TTTCCACCACAGGCCGCAAGGGG + Intergenic
1137961660 16:52887442-52887464 CTGCCAGAACAAGACCCATGAGG - Intergenic
1140612772 16:76621256-76621278 TTTCCTGCACAAGACTCATGAGG + Intronic
1143777401 17:9208609-9208631 TTCCAAGCACAAGTGCCAAGGGG + Intronic
1147772906 17:42879808-42879830 TTTCCATCACAGGACCCAGACGG - Intergenic
1149344488 17:55720747-55720769 TTTCCAGCACAAGGCACTGGAGG + Exonic
1153115266 18:1647371-1647393 ATGCCAGCACAAGAAGCAAGGGG + Intergenic
1154122836 18:11665433-11665455 TTCCCAGCTCCAAACCCAAGGGG + Intergenic
1161995791 19:7710507-7710529 TTTCCAGCACAAACCCCCATTGG + Intergenic
1162274213 19:9640142-9640164 TTTACAGCCCTAGACCCATGGGG - Intronic
1163751554 19:19081265-19081287 TTTCCAGCACTGGACCCATAAGG + Intronic
1164927225 19:32139945-32139967 CTTGAAGCACAAGACCCAAGGGG + Intergenic
1166177182 19:41082418-41082440 TGTCAGGCCCAAGACCCAAGTGG + Intergenic
1167506558 19:49873948-49873970 TGTCCTGCACAAGGCCCAGGGGG + Intronic
925791983 2:7498970-7498992 TTTCCAACACAAGTCCCCAAAGG + Intergenic
928415933 2:31091755-31091777 TAACCATCACAAGACCCCAGAGG - Intronic
933399132 2:81769319-81769341 TTACCAGAATAAGGCCCAAGAGG + Intergenic
940992447 2:160111484-160111506 TTTCCAGAGCAAGACTCCAGGGG + Intronic
943395283 2:187325806-187325828 TTTCCAGCACATGAACCCTGGGG - Intergenic
944288179 2:197975470-197975492 TTTCCAGCCAAAAACCCAATTGG + Intronic
944509829 2:200453631-200453653 TTGCCAGCTCAAGGCCCACGTGG + Intronic
945427364 2:209723199-209723221 TGTTCAGCACAGGACCCTAGAGG - Intronic
947358695 2:229323828-229323850 TTTCCATCAGTAGACTCAAGAGG - Intergenic
948157981 2:235800000-235800022 TCTACAGCAAAAAACCCAAGTGG - Intronic
948716593 2:239869468-239869490 GTACCAGCCCCAGACCCAAGCGG + Intergenic
1169243905 20:4009776-4009798 TTTCCATGACACCACCCAAGTGG - Intronic
1169421373 20:5463470-5463492 TTTCAAGCAGAAAACACAAGTGG - Intergenic
1169856225 20:10106291-10106313 TATCCAGCGCATGACCCAAGGGG - Intergenic
1170877056 20:20259733-20259755 TTCCCAACTCAAGACCTAAGAGG - Intronic
1172181418 20:33006121-33006143 TTTCCAGCACAAGAGCCATTTGG - Intergenic
1174818498 20:53707262-53707284 TCTCCATCACAAAACCCCAGAGG + Intergenic
1175604735 20:60303425-60303447 TCTCCAGCACAGCACCCCAGGGG + Intergenic
1175893160 20:62324180-62324202 CTGCCAGCACAACACCGAAGGGG - Exonic
1176327228 21:5511119-5511141 TGTCCAGCAAAAGCCCCATGTGG + Intergenic
1176400529 21:6309832-6309854 TGTCCAGCAAAAGCCCCATGTGG - Intergenic
1176436628 21:6679272-6679294 TGTCCAGCAAAAGCCCCATGTGG + Intergenic
1176460890 21:7006342-7006364 TGTCCAGCAAAAGCCCCATGTGG + Intergenic
1176484451 21:7388120-7388142 TGTCCAGCAAAAGCCCCATGTGG + Intergenic
1176763074 21:12979695-12979717 TTTCCAACACAGGGCCCAAAGGG + Intergenic
1176927826 21:14771514-14771536 TTGCCAGCAAAAGAACCAACTGG + Intergenic
1177580084 21:23010518-23010540 TTTCCATCACATGTCCCATGAGG + Intergenic
1177766888 21:25468871-25468893 TTTACATCAAAAGACCCAATTGG - Intergenic
1179397176 21:41051419-41051441 TTCCCAACACAACACCCTAGGGG + Intergenic
1179435776 21:41361151-41361173 TTCCCATCACCAGAGCCAAGAGG - Intergenic
1180325511 22:11373013-11373035 TTTCCACCACAAGCCGCAAAGGG - Intergenic
1180526711 22:16271615-16271637 TTTCCACCACAGGCCTCAAGGGG - Intergenic
1184443876 22:44535882-44535904 TTCCCCACACAAGACCCATGGGG - Intergenic
1185049505 22:48546442-48546464 TTTCCCCCACAAGCTCCAAGAGG - Intronic
1185070112 22:48651473-48651495 TTCCCAGCCCAGGACCCAGGTGG - Intronic
950767179 3:15281506-15281528 TCTCCAGCAGAAGAACCAGGTGG + Intronic
951422695 3:22506457-22506479 ATAACAGCACAAAACCCAAGGGG - Intergenic
951994334 3:28710498-28710520 TTTCCTGCACAAGAAACACGTGG - Intergenic
952407770 3:33019869-33019891 TTTCCAGCAAAAAACCCCAAAGG - Intronic
957027089 3:75194126-75194148 TTTCCAGCCAAAAACTCAAGGGG - Intergenic
958239080 3:91041193-91041215 TTTCCACCATAAGCCCCAAACGG - Intergenic
958934745 3:100244362-100244384 TTTCCAGTTCTAGACCCTAGAGG + Intergenic
960301895 3:116012672-116012694 ATTCCAGCACAATAACCACGGGG - Intronic
966593945 3:181710573-181710595 TTGCCCGCCCAGGACCCAAGAGG - Intergenic
966885235 3:184373869-184373891 TTTGCAGCACTAGAACCAAGAGG - Intronic
967024486 3:185552827-185552849 TTTCATTCACAAGAACCAAGGGG - Intergenic
967917261 3:194588001-194588023 CTTCCAGCAGATAACCCAAGTGG + Exonic
972353476 4:38259300-38259322 TTTCTTGCACAAGATCCAAGAGG - Intergenic
972626639 4:40805733-40805755 TCTCCAGCACAGGCCCCAGGAGG - Intronic
978391856 4:108235577-108235599 TTTCCTGCACATGACTCAGGTGG - Intergenic
981136400 4:141215121-141215143 TTTCCAGTGCATGACCAAAGTGG - Intergenic
982317358 4:154045252-154045274 TTCCCTGCACAAGACCAGAGTGG + Intergenic
984235720 4:177155773-177155795 TTACAAGCACAAGCCCAAAGAGG + Intergenic
984930903 4:184846358-184846380 TCGCTAGCACAAAACCCAAGCGG - Intergenic
987071561 5:14341878-14341900 TTTGCAGAACTAGAACCAAGAGG - Intronic
988270759 5:29013562-29013584 AGTCCACCACAAGAACCAAGAGG + Intergenic
988879127 5:35481441-35481463 TTTCCTGCACAAGAAACAAAAGG - Intergenic
991483540 5:67110279-67110301 TTTCCAGCACCAGAGCTAAATGG + Intronic
998554416 5:143109244-143109266 TCTCCAGCACAATGACCAAGAGG + Intronic
1000127527 5:158261082-158261104 TTTCAAGGACAAGACCCAGGGGG + Intergenic
1001561617 5:172673371-172673393 TTTCCATCACAAGGAACAAGGGG + Intronic
1003105606 6:3212859-3212881 TTGTCAGCTGAAGACCCAAGAGG - Intergenic
1006457575 6:34140724-34140746 TTTCCAGCACAAGACCCAAGTGG + Intronic
1012523276 6:100146206-100146228 TTTCCAGGAGAAGATCCAAAAGG + Intergenic
1018638979 6:165889761-165889783 TTTCCTGCAGGAAACCCAAGAGG + Intronic
1025525022 7:61795326-61795348 TTTTCACCATAAGACTCAAGGGG + Intergenic
1025548400 7:62207890-62207912 TTTTCACCATAAGACTCAAGGGG + Intergenic
1026601452 7:71781054-71781076 TTTTGAACACAAGTCCCAAGAGG - Exonic
1030589840 7:111467096-111467118 TGATCAGCAGAAGACCCAAGTGG + Intronic
1031922644 7:127613062-127613084 TTTCCAACAGAAGAGCCAAATGG - Exonic
1046741136 8:117830197-117830219 ATTCAAGCCCAAGAGCCAAGTGG + Intronic
1049812953 8:144583945-144583967 TGTCCAGCACATCACTCAAGGGG + Intronic
1051735093 9:20189826-20189848 TTTCCAGCCCTAGAAACAAGTGG + Intergenic
1054777767 9:69138434-69138456 TTTCCATCACAAGACAAAACTGG + Intronic
1057935749 9:99237379-99237401 TTTTCAGCACAATGACCAAGTGG - Intergenic
1058936925 9:109778433-109778455 TTTCCAGCACAAGCCCCAGCAGG - Intronic
1061545295 9:131300921-131300943 TTTCCAGCACAGGGCCCTAATGG - Intronic
1061733104 9:132631927-132631949 TTACCAGGGCAACACCCAAGAGG + Intronic
1203434886 Un_GL000195v1:129387-129409 TGTCCAGCAAAAGCCCCATGTGG - Intergenic
1203400475 Un_KI270519v1:87366-87388 TTTCCAACACAGGACTCAAAAGG - Intergenic
1189988122 X:46571736-46571758 ATCCCAGCACAAGGCCGAAGTGG + Intergenic
1190193529 X:48296910-48296932 TCTCCATCACAGGACCCAAAAGG - Intergenic
1190660043 X:52645533-52645555 TCTCCATCACAGGACCCAAAAGG - Exonic
1190666217 X:52698078-52698100 TCTCCATCACAGGACCCAAAAGG - Exonic
1190673201 X:52760332-52760354 TCTCCATCACAGGACCCAAAAGG + Exonic
1191571739 X:62633765-62633787 TTTCCAACATAAGCCCCAAAGGG - Intergenic
1195713288 X:107792795-107792817 TTGCCACTACAACACCCAAGAGG - Intronic
1197555135 X:127943875-127943897 TATCCAGAATAAAACCCAAGAGG + Intergenic
1197989689 X:132304568-132304590 TATTCAGCAAAAGACTCAAGGGG + Intergenic
1199153445 X:144517356-144517378 TTTCCAGTAACAGACCCAAAAGG + Intergenic
1200325245 X:155231136-155231158 TTTTCTGCTCAAGACCCCAGTGG + Intronic
1201081062 Y:10247296-10247318 TTTCCACAATAAGACCCAAAAGG + Intergenic
1201081448 Y:10254273-10254295 TTTCCACAATAAGACCCAAAAGG + Intergenic
1201081865 Y:10261768-10261790 TTTCCACAATAAGACCCAAAAGG + Intergenic
1201082954 Y:10331362-10331384 TTTCCACAATAAGACCCAAAAGG - Intergenic
1201083277 Y:10337150-10337172 TTTCCACAATAAGACCCAAAAGG - Intergenic
1201083600 Y:10342938-10342960 TTTCCACAATAAGACCCAAAAGG - Intergenic
1201083921 Y:10348724-10348746 TTTCCACAATAAGACCCAAAAGG - Intergenic
1201084244 Y:10354517-10354539 TTTCCACAATAAGACCCAAAAGG - Intergenic
1201084565 Y:10360299-10360321 TTTCCACAATAAGACCCAAAAGG - Intergenic
1201084868 Y:10365754-10365776 TTTCCACAATAAGACCCAAAAGG - Intergenic
1201085189 Y:10371543-10371565 TTTCCACAATAAGACCCAAAAGG - Intergenic
1201085195 Y:10371714-10371736 TTTCCACAATAAGACCCAAAAGG - Intergenic
1201085517 Y:10377502-10377524 TTTCCACAATAAGACCCAAAAGG - Intergenic
1201085840 Y:10383287-10383309 TTTCCACAATAAGACCCAAAAGG - Intergenic
1201086160 Y:10389073-10389095 TTTCCACAATAAGACCCAAAAGG - Intergenic
1201086482 Y:10394864-10394886 TTTCCACAATAAGACCCAAAAGG - Intergenic
1201086807 Y:10400659-10400681 TTTCCACAATAAGACCCAAAAGG - Intergenic
1201087131 Y:10406444-10406466 TTTCCACAATAAGACCCAAAAGG - Intergenic
1201087452 Y:10412230-10412252 TTTCCACAATAAGACCCAAAAGG - Intergenic
1201087773 Y:10418013-10418035 TTTCCACAATAAGACCCAAAAGG - Intergenic
1201088095 Y:10423801-10423823 TTTCCACAATAAGACCCAAAAGG - Intergenic
1201088420 Y:10429592-10429614 TTTCCACAATAAGACCCAAAAGG - Intergenic
1201088426 Y:10429763-10429785 TTTCCACAATAAGACCCAAAAGG - Intergenic
1201088729 Y:10435219-10435241 TTTCCACAATAAGACCCAAAAGG - Intergenic
1201089050 Y:10441002-10441024 TTTCCACAATAAGACCCAAAAGG - Intergenic
1201089373 Y:10446787-10446809 TTTCCACAATAAGACCCAAAAGG - Intergenic
1201089695 Y:10452573-10452595 TTTCCACAATAAGACCCAAAAGG - Intergenic
1201089998 Y:10458024-10458046 TTTCCACAATAAGACCCAAAAGG - Intergenic
1201090320 Y:10463812-10463834 TTTCCACAATAAGACCCAAAAGG - Intergenic
1201090643 Y:10469598-10469620 TTTCCACAATAAGACCCAAAAGG - Intergenic
1201090968 Y:10475383-10475405 TTTCCACAATAAGACCCAAAAGG - Intergenic
1201091291 Y:10481171-10481193 TTTCCACAATAAGACCCAAAAGG - Intergenic
1201091615 Y:10486964-10486986 TTTCCACAATAAGACCCAAAAGG - Intergenic
1201091939 Y:10492751-10492773 TTTCCACAATAAGACCCAAAAGG - Intergenic
1201092263 Y:10498537-10498559 TTTCCACAATAAGACCCAAAAGG - Intergenic
1201092601 Y:10504662-10504684 TTTCCACAATAAGACCCAAAAGG - Intergenic
1201092924 Y:10510448-10510470 TTTCCACAATAAGACCCAAAAGG - Intergenic
1201093184 Y:10515052-10515074 TTTCCACAATAAGACCCAAAAGG - Intergenic
1201094019 Y:10530026-10530048 TTTCCACAATAAGACCCAAAAGG - Intergenic
1201094025 Y:10530197-10530219 TTTCCACAATAAGACCCAAAAGG - Intergenic
1201094350 Y:10535983-10536005 TTTCCACAATAAGACCCAAAAGG - Intergenic
1201094690 Y:10542108-10542130 TTTCCACAATAAGACCCAAAAGG - Intergenic
1201094833 Y:10594614-10594636 TTTCCACAATAAGACCCAAAAGG + Intergenic
1201095027 Y:10597988-10598010 TTTCCACAATAAGACCCAAAAGG + Intergenic
1201095355 Y:10603942-10603964 TTTCCACAATAAGACCCAAAAGG + Intergenic
1201095361 Y:10604113-10604135 TTTCCACAATAAGACCCAAAAGG + Intergenic
1201095683 Y:10609899-10609921 TTTCCACAATAAGACCCAAAAGG + Intergenic
1201095690 Y:10610071-10610093 TTTCCACAATAAGACCCAAAAGG + Intergenic
1201096012 Y:10615851-10615873 TTTCCACAATAAGACCCAAAAGG + Intergenic