ID: 1006459875

View in Genome Browser
Species Human (GRCh38)
Location 6:34152135-34152157
Sequence GTAGAACCAAGGCTAGAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 1, 2: 1, 3: 12, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006459875_1006459880 19 Left 1006459875 6:34152135-34152157 CCACACTCTAGCCTTGGTTCTAC 0: 1
1: 1
2: 1
3: 12
4: 184
Right 1006459880 6:34152177-34152199 ATGTTTGCTCCTTCCCAAGCAGG 0: 1
1: 0
2: 2
3: 9
4: 172
1006459875_1006459878 -7 Left 1006459875 6:34152135-34152157 CCACACTCTAGCCTTGGTTCTAC 0: 1
1: 1
2: 1
3: 12
4: 184
Right 1006459878 6:34152151-34152173 GTTCTACTTAGGAAACTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006459875 Original CRISPR GTAGAACCAAGGCTAGAGTG TGG (reversed) Intronic
900110725 1:1004388-1004410 GAGGAACCAAGGCTGGGGTGGGG + Intergenic
901099701 1:6710073-6710095 CCATCACCAAGGCTAGAGTGCGG - Intergenic
901557130 1:10040571-10040593 AGAGCACCAAGGCCAGAGTGGGG - Intronic
902658999 1:17888265-17888287 GTAGAACCAAGATCAGAGAGCGG - Intergenic
904800031 1:33086048-33086070 GTAGAAGAAAGGGCAGAGTGAGG + Intronic
905980682 1:42223429-42223451 GAAGAACTTAGGCTGGAGTGTGG - Intronic
906159015 1:43633854-43633876 GTAGAATCTAGGCCAGGGTGTGG + Intergenic
906474175 1:46156746-46156768 GCAGTACCAGGGCCAGAGTGTGG - Intronic
906793618 1:48679438-48679460 GTACAACCAGGGCCACAGTGGGG + Intronic
907472712 1:54684757-54684779 TAAGCACCAAGGCTAGAGAGGGG - Intronic
908545942 1:65162207-65162229 GTATCGCCCAGGCTAGAGTGCGG - Intronic
908776447 1:67645649-67645671 ATGGAACCAAAGCTAGTGTGTGG + Intergenic
911776281 1:101817126-101817148 TTTGAACAAAGGCTAGTGTGAGG - Intronic
913533702 1:119751401-119751423 GTGTCACCCAGGCTAGAGTGTGG + Intronic
914694680 1:150066895-150066917 GTAGAACTAAAACTAGCGTGGGG - Intergenic
915608557 1:156971635-156971657 GTAGAACTGGGGGTAGAGTGAGG - Intronic
918842205 1:189556303-189556325 GTAGAAGCAAAGGTAGAGTTGGG - Intergenic
922463388 1:225829575-225829597 GGAGGAGCAAGGCTTGAGTGGGG + Intronic
923260373 1:232262189-232262211 CTATCACCAAGGCTGGAGTGCGG + Intergenic
1063925833 10:10976329-10976351 GTTGATCCAAGTCTAGAATGTGG + Intergenic
1066048052 10:31611648-31611670 GAAGTACCCAGGCTAGAGTATGG + Intergenic
1069459490 10:68580931-68580953 CTGCCACCAAGGCTAGAGTGCGG - Intronic
1071144559 10:82552861-82552883 GGAGGCCCAAGGCTAGAGTTTGG - Intronic
1071524865 10:86352741-86352763 GCAAAACCAAGGCCAGACTGGGG - Intronic
1074345827 10:112685373-112685395 CTAGAAACAATGCTAGAGAGGGG - Intronic
1075909022 10:126107529-126107551 TTGGAAACAAGGCTAGAGTGAGG + Intronic
1076429539 10:130391857-130391879 GTGGAGCCAAGGCTCAAGTGAGG + Intergenic
1078507499 11:11963688-11963710 GTGGCACCAAGGCTGGTGTGGGG + Exonic
1078592147 11:12651801-12651823 CTATCACCCAGGCTAGAGTGTGG + Intergenic
1079636857 11:22753276-22753298 GAAGAAACAAGGCCAGACTGTGG - Intronic
1079919198 11:26410687-26410709 GCAGAACAAAGACTAGTGTGGGG + Intronic
1080539999 11:33256879-33256901 GTAGAACCTAGTTTAGATTGAGG + Intronic
1087517913 11:99189004-99189026 GTAGAATCAAGGGTTGAGGGAGG - Intronic
1088268441 11:108009380-108009402 GTAAAACCCAAGCTGGAGTGAGG - Intronic
1089403786 11:118180918-118180940 GCAGAGCCAAGGCAAGAGAGGGG + Intergenic
1089694219 11:120206767-120206789 GGAGAACCAGGGATGGAGTGAGG - Intergenic
1090555147 11:127866611-127866633 GTAGAACTAAGGCCAGAGATGGG + Intergenic
1092025391 12:5235218-5235240 GTGTAACCCAGGCTGGAGTGCGG + Intergenic
1092267338 12:6992294-6992316 GTCTTACCCAGGCTAGAGTGCGG - Intronic
1096514928 12:52150486-52150508 GCAGAATCAAGGCTAGACGGGGG - Intergenic
1098003764 12:65972823-65972845 GTAGAACCATGGCTAGAATAGGG - Intergenic
1098619060 12:72569259-72569281 GTAGAATGAAGGCTATAGTTTGG - Intronic
1100826356 12:98478430-98478452 CTATCACCCAGGCTAGAGTGCGG + Intergenic
1102450182 12:113036303-113036325 GTATCACCCAGGCTGGAGTGCGG - Intergenic
1102976616 12:117211365-117211387 CTGCAACCAAGGCTTGAGTGAGG - Exonic
1103579506 12:121903789-121903811 GTGTCACCCAGGCTAGAGTGTGG + Intronic
1104863516 12:131938646-131938668 TTAGAACCAAGAGCAGAGTGAGG - Intronic
1106237801 13:27879459-27879481 TTGTCACCAAGGCTAGAGTGCGG - Intergenic
1107643228 13:42466307-42466329 TTAGAACCAAGGAAATAGTGCGG + Intergenic
1107909894 13:45095863-45095885 CTAGCACCCAGGCTGGAGTGCGG + Intergenic
1108628852 13:52260613-52260635 GTGTCACCCAGGCTAGAGTGCGG - Intergenic
1108657204 13:52545840-52545862 GTGTCACCCAGGCTAGAGTGCGG + Intergenic
1111645666 13:91028987-91029009 GTAGAACCCAGGGTAGATAGCGG + Intergenic
1112393160 13:99003465-99003487 GTAGGACCATAGCTAGAGTGTGG - Intronic
1112645617 13:101328346-101328368 CTACAGCCCAGGCTAGAGTGCGG + Intronic
1113084443 13:106553952-106553974 ATAAAACAAAGGCTAGGGTGTGG - Intronic
1117544839 14:56784262-56784284 GTATCACCCAGGCTAGAGTGCGG - Intergenic
1119396489 14:74329907-74329929 GTATCACCCAGGCTGGAGTGCGG + Intronic
1120750649 14:88194683-88194705 GTATAACAAAGGCTAGATCGTGG + Intronic
1122859952 14:104578038-104578060 GCAGAGCCCAGGCTGGAGTGAGG + Intronic
1123433918 15:20241114-20241136 CTATCACCCAGGCTAGAGTGTGG + Intergenic
1124472337 15:29999391-29999413 TTAGACCCAAAACTAGAGTGAGG + Intergenic
1124505760 15:30271859-30271881 GTAGAAGCCAGGCTGAAGTGTGG + Intergenic
1124737793 15:32266773-32266795 GTAGAAGCCAGGCTGAAGTGTGG - Intergenic
1126056702 15:44736531-44736553 GAAGCAGCAAGGCCAGAGTGAGG - Exonic
1127658281 15:61076032-61076054 GTAGAAGCAGGGCTAGAGGGCGG - Intronic
1127659604 15:61088023-61088045 ATTGAACCAAGTCAAGAGTGGGG - Intronic
1127733906 15:61824228-61824250 GTCGAAACAAGGCAAGAGAGGGG - Intergenic
1128226577 15:66005816-66005838 GCTGAGCCAGGGCTAGAGTGTGG - Intronic
1128671100 15:69575370-69575392 GTACAGCCAGGGCTAGAGAGTGG - Intergenic
1130811678 15:87385643-87385665 GCAGAGCCAAGACTAGACTGTGG + Intergenic
1131863130 15:96675948-96675970 GTAGAATAAAGGAAAGAGTGTGG + Intergenic
1132057057 15:98660315-98660337 GCAGAATCAAGGCCAGAGAGAGG - Intronic
1133314364 16:4873242-4873264 GTAGAACCAAGGCTAGAGGGGGG - Intronic
1134322766 16:13178685-13178707 GTAGACCCAAGGCTGGAGGCTGG - Intronic
1135758676 16:25118786-25118808 GGAGCACCAAGACTAGGGTGAGG + Intronic
1135974038 16:27095518-27095540 CAAGAACCAGGACTAGAGTGAGG - Intergenic
1137368498 16:47882311-47882333 ATACAACCCATGCTAGAGTGTGG + Intergenic
1138995647 16:62449474-62449496 GGAGAAGGAAGGATAGAGTGAGG - Intergenic
1139514808 16:67446722-67446744 GGAGCACCAAGGCTACATTGGGG - Intronic
1142797581 17:2320596-2320618 GTCCAACCCAGGCTGGAGTGCGG + Intronic
1146756447 17:35435796-35435818 CTGGCACCCAGGCTAGAGTGCGG + Exonic
1148473228 17:47909047-47909069 GTAGAACCAAGACTCCTGTGTGG - Intronic
1148996343 17:51713587-51713609 CTAGAGCAAAGGGTAGAGTGTGG + Intronic
1151542203 17:74770329-74770351 GTAGAAGCAAGGGTGGGGTGGGG - Intergenic
1155988949 18:32259511-32259533 CTATCACCCAGGCTAGAGTGCGG + Intronic
1157152399 18:45231237-45231259 GTATCACCCAGGCTAGAGAGTGG + Intronic
1159687629 18:71442996-71443018 GAAGAAACAGGGCTATAGTGCGG + Intergenic
1161966780 19:7553518-7553540 GAGGAACCAAGGCCAGAATGAGG + Intronic
1164935402 19:32206512-32206534 GTAGAACAAAGGCTAGAATTAGG - Intergenic
1166302837 19:41921976-41921998 GTAGAATGAAGGCAAGGGTGGGG - Intronic
1166724914 19:45021137-45021159 GTATCACCTAAGCTAGAGTGCGG - Intronic
1167586813 19:50379994-50380016 GTTGAGCCAAGGTGAGAGTGAGG + Intronic
1168564374 19:57411268-57411290 GTTGTACAGAGGCTAGAGTGAGG + Exonic
926682304 2:15673241-15673263 TTAGAGCCAGGGCAAGAGTGTGG + Intergenic
927255441 2:21036894-21036916 GTTGAGCCAAGGCTTGAGTCAGG - Intronic
927288860 2:21384909-21384931 GTAAAACCAAGTTTGGAGTGTGG - Intergenic
927490302 2:23516889-23516911 GCAGAACCAAGTCTTGCGTGTGG + Intronic
927576071 2:24202701-24202723 GGAAAACCAAGGACAGAGTGAGG - Intergenic
928270483 2:29850681-29850703 GTACAACCAAGTCTAGGGAGAGG - Intronic
928910452 2:36415640-36415662 GTGGAACCAAGGCTAGCTGGGGG + Intronic
931207972 2:60166128-60166150 GTATAACAAATGCTGGAGTGGGG + Intergenic
933456164 2:82522721-82522743 CTGGAACCCAGGCTGGAGTGCGG + Intergenic
934052732 2:88223888-88223910 GATGAACCAAGGCTAGAAAGTGG - Intergenic
937018127 2:118624989-118625011 TTTGAACCAAGGATAGAATGAGG + Intergenic
937813999 2:126231257-126231279 GTAGCACCAAGCCTACATTGGGG + Intergenic
940343395 2:152604252-152604274 GCAGAACCAAGGCTAGAACCAGG - Intronic
941078200 2:161030439-161030461 GTAGACCCATGGCTACAGTGTGG + Intergenic
943172156 2:184415608-184415630 ATAGAACCAATGCTAGTTTGAGG + Intergenic
944702095 2:202254913-202254935 CTGTCACCAAGGCTAGAGTGTGG + Intergenic
945792209 2:214318876-214318898 GTAGAGGCAAGCCTGGAGTGAGG + Intronic
946277979 2:218644872-218644894 GTAGTGGCAAGGGTAGAGTGGGG + Exonic
947200017 2:227606824-227606846 ATAGAACAAAAGATAGAGTGAGG - Intergenic
948390095 2:237605797-237605819 CTAGCACCCAGGCTGGAGTGCGG - Intergenic
1169184174 20:3598976-3598998 GTAGAACAAAGTCTATAGTGTGG + Intronic
1169197764 20:3692663-3692685 GTGGTACCAAGTATAGAGTGTGG + Exonic
1169962443 20:11176906-11176928 CTATCACCCAGGCTAGAGTGCGG + Intergenic
1171959769 20:31485411-31485433 GCAGAAACAAGCCTAGAGAGGGG + Intergenic
1174652894 20:52143568-52143590 CTGTCACCAAGGCTAGAGTGCGG + Intronic
1174788176 20:53452560-53452582 GTGTCACCCAGGCTAGAGTGCGG - Intronic
1175395023 20:58651686-58651708 GTAGATCCAAGGTTGGATTGGGG + Exonic
1178846228 21:36176286-36176308 GCAGCACCAAGGCTCCAGTGGGG - Intronic
1180252909 21:46601403-46601425 TTAGAACCAAGGCTGGCTTGAGG - Intronic
1181986820 22:26805617-26805639 GTGGAGCCAAGGCTAGAGCCTGG - Intergenic
1184325506 22:43780543-43780565 GTACAAAGAAGACTAGAGTGAGG - Intronic
1184994374 22:48194624-48194646 GTAGAAACTAGGCTAGTTTGAGG - Intergenic
1185045844 22:48528383-48528405 GTATAGCCAAGGCCATAGTGAGG + Intronic
949475732 3:4443238-4443260 CTGTCACCAAGGCTAGAGTGCGG - Intronic
950309681 3:11946161-11946183 GAAGAACCAAGATTAGAGTGTGG + Intergenic
950873014 3:16245491-16245513 GTAGGACCAGCCCTAGAGTGGGG - Intergenic
953463321 3:43098810-43098832 GATAAACCAAGGCTTGAGTGTGG + Intronic
953494226 3:43372481-43372503 GCAGAACCAAGGTTGGATTGCGG - Intronic
955132638 3:56186395-56186417 GTAGAACAAAGGCCAGTGTATGG - Intronic
959287463 3:104434564-104434586 CTAGTGCCCAGGCTAGAGTGCGG + Intergenic
960518629 3:118629946-118629968 ATAGTGCCAAGGCTAGAGAGAGG + Intergenic
960655144 3:119995294-119995316 GTATAACCCAGGCTGGAGAGCGG - Intronic
964879962 3:161412029-161412051 CTAGAAGCCAGGCTAGAGTTTGG + Intergenic
965610497 3:170538598-170538620 GTAAAGCCAAGAGTAGAGTGAGG - Intronic
966018383 3:175173253-175173275 GTGTCACCAAGGCTGGAGTGCGG - Intronic
966940953 3:184746713-184746735 GTTGCATCAAGGCCAGAGTGTGG - Intergenic
967363585 3:188660159-188660181 GGAGAACCAAGGCAAAAGTAAGG - Intronic
971906707 4:32735678-32735700 CTAGAAGCCAAGCTAGAGTGTGG - Intergenic
972668845 4:41194625-41194647 CTGTCACCAAGGCTAGAGTGCGG - Intronic
976723993 4:88197764-88197786 GTATCACCCAGGCTGGAGTGCGG - Intronic
977976961 4:103277186-103277208 GTATCACCTAGGCTGGAGTGCGG + Intergenic
978465314 4:109002524-109002546 ATAGAACAAAGGCTGGAGGGTGG + Intronic
981546351 4:145898116-145898138 CTATAGCCCAGGCTAGAGTGCGG - Intronic
985689120 5:1297366-1297388 GTAGAATCAGGGCGCGAGTGTGG - Intergenic
988908167 5:35811285-35811307 GAAGAGCAAAAGCTAGAGTGTGG + Intronic
988919858 5:35930601-35930623 GCAGAACCAAGACTAGAGTGGGG - Intronic
991944250 5:71884034-71884056 GTCTAACCAAGGCTAGACTGTGG + Intergenic
992323367 5:75636374-75636396 AAAGAACCAAGGCAAGAGTATGG + Intronic
996098472 5:119423438-119423460 GTAGAACCATTGCTAGAGCCAGG - Intergenic
997613152 5:135229249-135229271 GGGGCACCAAGGCCAGAGTGTGG + Intronic
1000630516 5:163585837-163585859 GTATCACCCAGGCTAGAGTGCGG + Intergenic
1001810911 5:174627631-174627653 GAAGAAGAAAGGCTAGGGTGAGG - Intergenic
1003920708 6:10830200-10830222 GTATCACCCAGGCTGGAGTGCGG + Intronic
1006459875 6:34152135-34152157 GTAGAACCAAGGCTAGAGTGTGG - Intronic
1007349070 6:41255576-41255598 GCAGAACCAGGGCTTCAGTGAGG + Intergenic
1008513250 6:52296950-52296972 GTCGTGCCCAGGCTAGAGTGCGG + Intergenic
1016152508 6:140760243-140760265 GTACAACCAAAGCTAGAGGCAGG + Intergenic
1016443630 6:144110100-144110122 CTAAGACCAAGGCAAGAGTGGGG + Intergenic
1016488419 6:144569094-144569116 TTAGACCCTAGGCTAGAGTATGG - Intronic
1023105771 7:36761939-36761961 CTAGAAGCCAGGCTAGAGTTGGG - Intergenic
1023893936 7:44416453-44416475 GTGTCACCCAGGCTAGAGTGCGG - Intronic
1025635134 7:63314960-63314982 GGAGGACCCAGGCTGGAGTGAGG + Intergenic
1025647561 7:63433210-63433232 GGAGGACCCAGGCTGGAGTGAGG - Intergenic
1026818185 7:73528743-73528765 GTATTACCCAGGCTGGAGTGCGG + Intergenic
1027389811 7:77693663-77693685 GTAGAGCCTAAGCAAGAGTGTGG - Intergenic
1029401156 7:100347336-100347358 CCAGAACCAAGGCTAGGATGAGG + Intronic
1030736819 7:113058910-113058932 GTGGAACCAAGGCTTCGGTGTGG - Intergenic
1030953694 7:115824178-115824200 GTGTCACCCAGGCTAGAGTGCGG - Intergenic
1032238461 7:130143220-130143242 GCAGAGCCAGGGCTAGGGTGAGG + Intergenic
1032311163 7:130788618-130788640 TCAGAAACAAGGCAAGAGTGAGG - Intergenic
1032892057 7:136207497-136207519 GTTGAACCATGGGTAGAATGTGG + Intergenic
1033967471 7:146993630-146993652 GTAGTAACAAGGCTTGAGCGGGG - Intronic
1035057658 7:156046718-156046740 GAAGCACCAAGGCTGAAGTGTGG + Intergenic
1041568225 8:59304770-59304792 GTCTCACCCAGGCTAGAGTGCGG - Intergenic
1046651427 8:116840515-116840537 GTAGGACCAAAGGTAGAGGGGGG - Intronic
1049148715 8:141020631-141020653 GTGGAACCAGGGTTAGGGTGGGG + Intergenic
1049520171 8:143083741-143083763 GTGTCACCCAGGCTAGAGTGAGG - Intergenic
1053661754 9:40288647-40288669 CTAGAGCAAAGGGTAGAGTGCGG - Intronic
1053912127 9:42917991-42918013 CTAGAGCAAAGGGTAGAGTGCGG - Intergenic
1054373879 9:64434883-64434905 CTAGAGCAAAGGGTAGAGTGCGG - Intergenic
1054522855 9:66087637-66087659 CTAGAGCAAAGGGTAGAGTGCGG + Intergenic
1054784802 9:69200422-69200444 GTATTGCCAAGGCTGGAGTGTGG + Intronic
1054955544 9:70905777-70905799 GTGGCACCCAGGCTGGAGTGCGG + Intronic
1058335908 9:103828798-103828820 CTATCACCAAGGCTGGAGTGTGG + Intergenic
1060867719 9:127013253-127013275 ACAGAACCAAGGCCATAGTGGGG - Intronic
1061516726 9:131094420-131094442 GTAAAATCAAGGCTACGGTGGGG + Intronic
1062026278 9:134342206-134342228 GTGGATCCCAGGCCAGAGTGAGG + Intronic
1185995587 X:4944713-4944735 GCAGAAGCAAGGCTAGAGCTTGG - Intergenic
1187048860 X:15676004-15676026 GGAGAAAGAGGGCTAGAGTGGGG - Intergenic
1187559571 X:20389119-20389141 GTAGAACCTGGACTAGAGTGAGG - Intergenic
1187715274 X:22096356-22096378 ATAGAGCCAGGGCTAGAGAGAGG + Intronic
1189260086 X:39672148-39672170 GTGTCACCCAGGCTAGAGTGTGG - Intergenic
1190322913 X:49188872-49188894 GAGGAACCAAGGCCAGAGTTGGG + Exonic
1193880135 X:86911321-86911343 GTACAACTAAGGCCACAGTGGGG - Intergenic
1201526807 Y:14945435-14945457 GTATTACCCAGGCTGGAGTGCGG + Intergenic