ID: 1006459889

View in Genome Browser
Species Human (GRCh38)
Location 6:34152221-34152243
Sequence GAGAGCTGGACGTAGGCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006459879_1006459889 30 Left 1006459879 6:34152168-34152190 CCATGGACAATGTTTGCTCCTTC 0: 1
1: 0
2: 1
3: 9
4: 187
Right 1006459889 6:34152221-34152243 GAGAGCTGGACGTAGGCCCCGGG No data
1006459881_1006459889 12 Left 1006459881 6:34152186-34152208 CCTTCCCAAGCAGGACCCAGACA 0: 1
1: 0
2: 3
3: 16
4: 268
Right 1006459889 6:34152221-34152243 GAGAGCTGGACGTAGGCCCCGGG No data
1006459883_1006459889 7 Left 1006459883 6:34152191-34152213 CCAAGCAGGACCCAGACAGCTGA 0: 1
1: 0
2: 7
3: 28
4: 229
Right 1006459889 6:34152221-34152243 GAGAGCTGGACGTAGGCCCCGGG No data
1006459882_1006459889 8 Left 1006459882 6:34152190-34152212 CCCAAGCAGGACCCAGACAGCTG 0: 1
1: 0
2: 6
3: 16
4: 228
Right 1006459889 6:34152221-34152243 GAGAGCTGGACGTAGGCCCCGGG No data
1006459885_1006459889 -4 Left 1006459885 6:34152202-34152224 CCAGACAGCTGACAAGACAGAGA 0: 1
1: 0
2: 2
3: 29
4: 233
Right 1006459889 6:34152221-34152243 GAGAGCTGGACGTAGGCCCCGGG No data
1006459884_1006459889 -3 Left 1006459884 6:34152201-34152223 CCCAGACAGCTGACAAGACAGAG 0: 1
1: 0
2: 1
3: 22
4: 250
Right 1006459889 6:34152221-34152243 GAGAGCTGGACGTAGGCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006459889 Original CRISPR GAGAGCTGGACGTAGGCCCC GGG Intronic
No off target data available for this crispr