ID: 1006463513

View in Genome Browser
Species Human (GRCh38)
Location 6:34177502-34177524
Sequence GCTCCCTCTCCTGCTGCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006463502_1006463513 12 Left 1006463502 6:34177467-34177489 CCTTTTACCACCTCTCAGCTCCC No data
Right 1006463513 6:34177502-34177524 GCTCCCTCTCCTGCTGCTAAGGG No data
1006463499_1006463513 18 Left 1006463499 6:34177461-34177483 CCCAGCCCTTTTACCACCTCTCA No data
Right 1006463513 6:34177502-34177524 GCTCCCTCTCCTGCTGCTAAGGG No data
1006463504_1006463513 5 Left 1006463504 6:34177474-34177496 CCACCTCTCAGCTCCCACCTGGG No data
Right 1006463513 6:34177502-34177524 GCTCCCTCTCCTGCTGCTAAGGG No data
1006463507_1006463513 2 Left 1006463507 6:34177477-34177499 CCTCTCAGCTCCCACCTGGGGTC No data
Right 1006463513 6:34177502-34177524 GCTCCCTCTCCTGCTGCTAAGGG No data
1006463496_1006463513 30 Left 1006463496 6:34177449-34177471 CCCTGTGCTGGCCCCAGCCCTTT No data
Right 1006463513 6:34177502-34177524 GCTCCCTCTCCTGCTGCTAAGGG No data
1006463508_1006463513 -8 Left 1006463508 6:34177487-34177509 CCCACCTGGGGTCCAGCTCCCTC No data
Right 1006463513 6:34177502-34177524 GCTCCCTCTCCTGCTGCTAAGGG No data
1006463500_1006463513 17 Left 1006463500 6:34177462-34177484 CCAGCCCTTTTACCACCTCTCAG No data
Right 1006463513 6:34177502-34177524 GCTCCCTCTCCTGCTGCTAAGGG No data
1006463498_1006463513 19 Left 1006463498 6:34177460-34177482 CCCCAGCCCTTTTACCACCTCTC No data
Right 1006463513 6:34177502-34177524 GCTCCCTCTCCTGCTGCTAAGGG No data
1006463497_1006463513 29 Left 1006463497 6:34177450-34177472 CCTGTGCTGGCCCCAGCCCTTTT No data
Right 1006463513 6:34177502-34177524 GCTCCCTCTCCTGCTGCTAAGGG No data
1006463501_1006463513 13 Left 1006463501 6:34177466-34177488 CCCTTTTACCACCTCTCAGCTCC No data
Right 1006463513 6:34177502-34177524 GCTCCCTCTCCTGCTGCTAAGGG No data
1006463509_1006463513 -9 Left 1006463509 6:34177488-34177510 CCACCTGGGGTCCAGCTCCCTCT No data
Right 1006463513 6:34177502-34177524 GCTCCCTCTCCTGCTGCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006463513 Original CRISPR GCTCCCTCTCCTGCTGCTAA GGG Intergenic
No off target data available for this crispr