ID: 1006467706

View in Genome Browser
Species Human (GRCh38)
Location 6:34206032-34206054
Sequence CCTTGCAACTCTGAGCCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006467694_1006467706 27 Left 1006467694 6:34205982-34206004 CCCTTGCCTGCCTAACAGCAGGG No data
Right 1006467706 6:34206032-34206054 CCTTGCAACTCTGAGCCCTGTGG No data
1006467704_1006467706 -3 Left 1006467704 6:34206012-34206034 CCAACTGACTTCTTGGGGTTCCT No data
Right 1006467706 6:34206032-34206054 CCTTGCAACTCTGAGCCCTGTGG No data
1006467696_1006467706 26 Left 1006467696 6:34205983-34206005 CCTTGCCTGCCTAACAGCAGGGG No data
Right 1006467706 6:34206032-34206054 CCTTGCAACTCTGAGCCCTGTGG No data
1006467700_1006467706 17 Left 1006467700 6:34205992-34206014 CCTAACAGCAGGGGACTGGACCA No data
Right 1006467706 6:34206032-34206054 CCTTGCAACTCTGAGCCCTGTGG No data
1006467698_1006467706 21 Left 1006467698 6:34205988-34206010 CCTGCCTAACAGCAGGGGACTGG No data
Right 1006467706 6:34206032-34206054 CCTTGCAACTCTGAGCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006467706 Original CRISPR CCTTGCAACTCTGAGCCCTG TGG Intergenic
No off target data available for this crispr