ID: 1006469931

View in Genome Browser
Species Human (GRCh38)
Location 6:34223059-34223081
Sequence TTGAAGAAGCAGGATGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006469926_1006469931 -9 Left 1006469926 6:34223045-34223067 CCACACCCCTATTCTTGAAGAAG No data
Right 1006469931 6:34223059-34223081 TTGAAGAAGCAGGATGATGATGG No data
1006469925_1006469931 -8 Left 1006469925 6:34223044-34223066 CCCACACCCCTATTCTTGAAGAA No data
Right 1006469931 6:34223059-34223081 TTGAAGAAGCAGGATGATGATGG No data
1006469923_1006469931 13 Left 1006469923 6:34223023-34223045 CCCTCATGATTATCATTTTTGCC No data
Right 1006469931 6:34223059-34223081 TTGAAGAAGCAGGATGATGATGG No data
1006469922_1006469931 14 Left 1006469922 6:34223022-34223044 CCCCTCATGATTATCATTTTTGC No data
Right 1006469931 6:34223059-34223081 TTGAAGAAGCAGGATGATGATGG No data
1006469924_1006469931 12 Left 1006469924 6:34223024-34223046 CCTCATGATTATCATTTTTGCCC No data
Right 1006469931 6:34223059-34223081 TTGAAGAAGCAGGATGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006469931 Original CRISPR TTGAAGAAGCAGGATGATGA TGG Intergenic
No off target data available for this crispr