ID: 1006477182

View in Genome Browser
Species Human (GRCh38)
Location 6:34263933-34263955
Sequence CCATCTTCACTTCCTTGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006477177_1006477182 6 Left 1006477177 6:34263904-34263926 CCTTCGCGGCCTGGGCTCATGTG No data
Right 1006477182 6:34263933-34263955 CCATCTTCACTTCCTTGAGTAGG No data
1006477178_1006477182 -3 Left 1006477178 6:34263913-34263935 CCTGGGCTCATGTGATCCTCCCA No data
Right 1006477182 6:34263933-34263955 CCATCTTCACTTCCTTGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006477182 Original CRISPR CCATCTTCACTTCCTTGAGT AGG Intergenic