ID: 1006482011

View in Genome Browser
Species Human (GRCh38)
Location 6:34303035-34303057
Sequence GCATTTATATGGATGGATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006482011_1006482015 5 Left 1006482011 6:34303035-34303057 CCTTTATCCATCCATATAAATGC 0: 1
1: 0
2: 2
3: 20
4: 181
Right 1006482015 6:34303063-34303085 ATCAGTTTTTTCAGATATTTTGG 0: 1
1: 0
2: 3
3: 40
4: 552
1006482011_1006482016 11 Left 1006482011 6:34303035-34303057 CCTTTATCCATCCATATAAATGC 0: 1
1: 0
2: 2
3: 20
4: 181
Right 1006482016 6:34303069-34303091 TTTTTCAGATATTTTGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006482011 Original CRISPR GCATTTATATGGATGGATAA AGG (reversed) Intronic
905851525 1:41278435-41278457 GCACATAAATGGATGGATAGTGG + Intergenic
908104193 1:60824640-60824662 ATATTTATATTGAGGGATAATGG - Intergenic
909351339 1:74656574-74656596 GCATTTTACTTGATGGATAATGG - Intronic
910098439 1:83550962-83550984 GCATTTAAATGCATGGGTATGGG + Intergenic
911583632 1:99664356-99664378 GAATTTATATGGATGTATATAGG + Intronic
911873972 1:103135281-103135303 AAATTTATATGGAAGAATAAAGG - Intergenic
914389136 1:147202820-147202842 GCAACTATATGGATGGATGGTGG - Intronic
915138274 1:153749297-153749319 CCCTTTATTTTGATGGATAAGGG - Intronic
916712034 1:167420005-167420027 TCATTTATTTGGAAAGATAAGGG + Exonic
918545485 1:185679150-185679172 GCATTTGTCAGGATGGATAGTGG - Intergenic
919004652 1:191881190-191881212 GAATTTAAATGAATGCATAATGG + Intergenic
920082532 1:203385719-203385741 GCATCTACATGGATGGAAAAGGG - Intergenic
921174788 1:212584614-212584636 GCATTTAAACTGATGGATCAAGG - Intronic
921686291 1:218092890-218092912 GGATAGAAATGGATGGATAAAGG + Intergenic
922586189 1:226736680-226736702 GCTTTTGTAAGGATGGAGAAGGG - Exonic
923288577 1:232521618-232521640 CAATTTAAATGGATGGATATAGG - Intronic
924684048 1:246269068-246269090 GCATTTAGTGGGATGGAAAAGGG - Intronic
1063687884 10:8256046-8256068 GCATTTACATGCATAAATAATGG + Intergenic
1063811640 10:9716221-9716243 GAATTTATATGAAAAGATAAAGG + Intergenic
1064547416 10:16464787-16464809 GCATGAAAATGGATGGATACAGG - Intronic
1064951810 10:20860747-20860769 GCCTTTAGATGTATGAATAAAGG - Intronic
1067818148 10:49499254-49499276 GCATTTATATAGATGTAGGAAGG - Intronic
1068027296 10:51662273-51662295 GCATTTAATTGTGTGGATAAGGG + Intronic
1068141961 10:53020384-53020406 GGATTTATAAGGGTGAATAAAGG + Intergenic
1068622660 10:59203952-59203974 TCATTTAGATGCATGTATAAGGG + Intronic
1070223777 10:74478813-74478835 GTACTTATAAGGATGGAGAATGG - Intronic
1072560141 10:96564827-96564849 CCATTAATATGGATAAATAAGGG + Intronic
1073664404 10:105514021-105514043 GCATTTCTTTTGATGGCTAAAGG + Intergenic
1073811824 10:107160834-107160856 GCCTTTATATGTATGCATAATGG - Intronic
1082077804 11:47987840-47987862 GCATGTAAATGGTAGGATAAGGG + Intronic
1086775205 11:90822451-90822473 GTAGTTAAATGGATGGAGAATGG - Intergenic
1087253190 11:95926435-95926457 GCATTTCTATGCATCTATAATGG + Intergenic
1087982549 11:104634064-104634086 GGAGTTCTATGGATGGAGAAGGG + Intergenic
1088896577 11:114083121-114083143 GCCTTTTTGTGGTTGGATAAAGG + Intronic
1095135523 12:38597026-38597048 GCATTTATATGGATGTTTTATGG - Intergenic
1095608765 12:44102465-44102487 GCATTTAGAGAGATGGATAGAGG - Intronic
1096751578 12:53762321-53762343 GCATATTTATTGATTGATAAAGG + Intergenic
1096885263 12:54712310-54712332 AAATTTATATGGAAGAATAAAGG - Intergenic
1097728450 12:63100645-63100667 CCACTTATATGGAAGGGTAAAGG + Intergenic
1099059294 12:77886149-77886171 GCATTCATATGGGTGCAGAATGG - Intronic
1101078999 12:101162615-101162637 GCATTAATTTGCTTGGATAATGG - Intronic
1101420469 12:104546572-104546594 GCTTCAATATGGATGGAAAAGGG + Intronic
1101969410 12:109302317-109302339 ACATATTTATGGATGGATTATGG + Intronic
1104111052 12:125704630-125704652 GCATTGAAATGCATGGAGAAAGG - Intergenic
1104906696 12:132217350-132217372 GTAGGTAGATGGATGGATAAAGG - Intronic
1104906762 12:132217662-132217684 GTAGGTAGATGGATGGATAAAGG - Intronic
1104906799 12:132217843-132217865 GTAGGTAGATGGATGGATAAAGG - Intronic
1108225392 13:48284352-48284374 GCATTTTTATGCATGTAGAATGG - Intergenic
1109733492 13:66449708-66449730 GCATTTAAATGTATGCATAATGG + Intronic
1110959305 13:81600946-81600968 GCATTTATATGGGTGATTATTGG - Intergenic
1111155227 13:84312723-84312745 ATATTTATATTCATGGATAAGGG + Intergenic
1111731935 13:92087445-92087467 GCATTTATTTGGGAAGATAATGG - Intronic
1112964069 13:105165382-105165404 GCATTTATAGTGATTAATAATGG - Intergenic
1114853489 14:26409145-26409167 GCATATATATGGGGGGATAAGGG - Intergenic
1115813724 14:37139501-37139523 GAAAATATATGGAGGGATAAAGG - Intronic
1116212170 14:41962461-41962483 ACAATTATATGGGTGGAGAAGGG + Intergenic
1117229938 14:53706637-53706659 CCAGTTAGATGGAAGGATAAAGG - Intergenic
1120748800 14:88178326-88178348 TCATTTGTATGTATAGATAATGG - Intergenic
1124356404 15:28998442-28998464 GCATTTATATGCATCCATACGGG - Intronic
1125029335 15:35060620-35060642 GCATTTCTATGCTTAGATAAGGG - Intergenic
1127865940 15:63032792-63032814 GCATTGTTGTGGATGGCTAAAGG + Intergenic
1128421994 15:67501147-67501169 GCATTTATAGGTTTGAATAAAGG + Exonic
1131908978 15:97175230-97175252 GCATATATATGGATGTATAATGG - Intergenic
1132967010 16:2662389-2662411 CCATTTAAATGGATGGACACAGG - Intergenic
1133748169 16:8703088-8703110 GTATTTATATGAAAGGATACTGG + Intronic
1137885858 16:52102778-52102800 CCATGTACATGGATGGGTAATGG - Intergenic
1138314551 16:56057999-56058021 ACATTTATATGAAAGAATAATGG + Intergenic
1138730639 16:59190228-59190250 GCATTTATAGGGTAGGATCATGG + Intergenic
1139681613 16:68569079-68569101 ACATTTAGCTGGATGGATATAGG - Intronic
1140169498 16:72588856-72588878 GAATTTTTATGGAAGGGTAAAGG - Intergenic
1142707521 17:1705777-1705799 GCTTTTCTGTGGATGGCTAAGGG + Exonic
1144314489 17:14046933-14046955 GGTTTTATATGGCTGGAAAAAGG - Intergenic
1151461285 17:74255746-74255768 GCATTTATAAGAAAGGACAAGGG + Intronic
1152084989 17:78212541-78212563 GCATGTATATGTATGTATATGGG - Intergenic
1153329452 18:3858590-3858612 GCATTTACATGTATAGATACTGG + Intronic
1153458535 18:5306277-5306299 GTATATATATGTATGTATAATGG - Intergenic
1153777660 18:8467842-8467864 GGGCGTATATGGATGGATAAGGG - Intergenic
1155717072 18:28956971-28956993 TCATTTTAATGGATCGATAATGG - Intergenic
1156137984 18:34068138-34068160 GCATTAATGTGCATGAATAATGG + Intronic
1156511269 18:37638865-37638887 GCATCTGTATGGTTGGAGAATGG + Intergenic
1156978577 18:43257571-43257593 GCATTAATATGCATGAATAAAGG + Intergenic
1157147771 18:45182890-45182912 GAATTTATCTGGAAGAATAAAGG + Intergenic
1159709810 18:71743080-71743102 ACATTTATATGGAAGCAAAAAGG + Intronic
1160526539 18:79541998-79542020 GGATGGACATGGATGGATAATGG - Intergenic
1160526669 18:79542604-79542626 GTAAATACATGGATGGATAATGG - Intergenic
1164083685 19:21882374-21882396 CCATTTAAATGGATGGACACAGG - Intergenic
1166173524 19:41049159-41049181 GAATTTAAATGGATGGTTAGGGG - Intergenic
1168225850 19:54994566-54994588 GCATTTACTAGGATGGTTAAAGG + Intronic
925932154 2:8717007-8717029 GCAATTAAATGGATGGATAAAGG - Intergenic
926341907 2:11910614-11910636 GCCTGTATATGGATGGATGAGGG - Intergenic
927708540 2:25311511-25311533 GCAGTGATCTGGATAGATAAGGG - Intronic
929850429 2:45583524-45583546 GCATCTATATGTATGTATACTGG - Intronic
930004621 2:46886541-46886563 GCATTTAGCAGGAAGGATAATGG - Intergenic
930336038 2:50047018-50047040 GAATGTATATGGATGCATTAAGG + Intronic
932847140 2:75147383-75147405 CACTTTATAGGGATGGATAAAGG - Intronic
938642733 2:133298598-133298620 GCATTATTATAGATGAATAATGG - Intronic
938981009 2:136527218-136527240 GTAACTATATGGATGTATAAAGG - Intergenic
941654325 2:168126963-168126985 GCATTTGAAGGGATGGATGATGG + Intronic
942406762 2:175664095-175664117 GCATTTATAGGGCTAGAGAAAGG + Intergenic
943139842 2:183968504-183968526 GCATTTAAATAGATTGATAATGG + Intergenic
944970719 2:204989783-204989805 GCAATGAAATGAATGGATAATGG - Intronic
946445456 2:219736406-219736428 GCATTTATTGGGAACGATAAAGG - Intergenic
948040344 2:234896601-234896623 GCATGTATTTGTATGCATAATGG + Intergenic
1170140895 20:13124173-13124195 TCATTTATATAAATGGATAATGG + Intronic
1172051195 20:32120127-32120149 GCATTTATATGGAAATACAAAGG - Intronic
1173104894 20:40124446-40124468 ACACTTATATGGGTGGATAAAGG - Intergenic
1174372146 20:50098101-50098123 ACTTTTAAATGGAGGGATAAAGG + Intronic
1174852707 20:54010754-54010776 ACATTTATATGGAAAGACAAAGG + Intronic
1178180384 21:30154117-30154139 GCATTTATATGTATGTGTAATGG + Intergenic
1179357336 21:40673008-40673030 GGATTTTTATGCAGGGATAATGG - Intronic
1181415629 22:22756763-22756785 GCATTTGTATGGAATGAAAAGGG + Intronic
1183760668 22:39813514-39813536 GCATTTATATGGATAGTTACAGG - Intronic
949315468 3:2749593-2749615 CCATTTATATGTTTGAATAAAGG + Intronic
949632818 3:5947342-5947364 ATATTTACATAGATGGATAAAGG - Intergenic
949746224 3:7295468-7295490 ACATTTATATGGAAAGGTAAAGG - Intronic
950209525 3:11111221-11111243 GAATTTATATGGAAAGGTAAAGG - Intergenic
951772778 3:26277284-26277306 GCCTTTATATGCATTGTTAAAGG - Intergenic
951888625 3:27549180-27549202 GCATACATAGGGATGGATACAGG - Intergenic
951947444 3:28156329-28156351 GCCTTAATATGGATATATAAGGG - Intergenic
954820378 3:53321335-53321357 GCATTTTTATGGATGGGAATAGG + Intronic
956800050 3:72749037-72749059 CCATTTTTATAGATGGATAGTGG - Intergenic
957320336 3:78622339-78622361 ACATTTATATTTATTGATAAGGG - Intronic
957580100 3:82060913-82060935 GCATTAATTTGTTTGGATAATGG + Intergenic
958032459 3:88128635-88128657 TCAGTTATATGGTTGGAAAAAGG - Intronic
963008634 3:140749473-140749495 GTATTTGGATGGATGGATGATGG + Intergenic
963288218 3:143458875-143458897 GTATTCATATGGAAGGAAAATGG - Intronic
963959300 3:151290751-151290773 GCATTAATAAGGATGTTTAAAGG + Intronic
964971095 3:162562442-162562464 ACATATATATGAATGAATAAGGG - Intergenic
965877990 3:173351473-173351495 ATATTTTTATGGAGGGATAAAGG + Intergenic
967595314 3:191321129-191321151 GCATTTAAATGTTTGGAAAATGG + Intronic
971347101 4:25821521-25821543 GCAGTTGTATGGATCGAAAAGGG - Intronic
971575279 4:28264893-28264915 GAAATTAAATGGATGGATAGGGG + Intergenic
971892295 4:32540580-32540602 GAGTATATATGGATGGATCATGG - Intergenic
972096395 4:35351887-35351909 CCATATATATGGAAAGATAATGG + Intergenic
972230862 4:37071362-37071384 ACTTTTATATGGATGGAGAAGGG - Intergenic
972310358 4:37876580-37876602 GCATATATATGAAAGGAAAATGG + Intergenic
972667973 4:41185120-41185142 GGAAATATATGGATGGATGAAGG + Intronic
972737433 4:41857139-41857161 GCTTTTATAAGGATGGACAATGG + Intergenic
976669291 4:87634288-87634310 GAATTTAAATGGATGGAAATAGG - Intergenic
976755752 4:88496307-88496329 AAATTTATATGGATGAACAAAGG + Intronic
976817645 4:89168075-89168097 GCATTTATATGAATGGTCCATGG - Intergenic
977115495 4:93019865-93019887 TAATTTTTATGGATGTATAATGG - Intronic
979653625 4:123165665-123165687 GAATTTATATGGATATAAAAAGG - Intronic
982321745 4:154084030-154084052 GCATATATATGCATTGAGAAAGG + Intergenic
988215079 5:28261606-28261628 TCATTAATATGAATGAATAAGGG + Intergenic
990604395 5:57394434-57394456 GCATGTATATGGATGGATTGAGG + Intergenic
990839125 5:60055871-60055893 TCAATTATAAGGAGGGATAAAGG + Intronic
991260490 5:64662534-64662556 GCTTTTATATGGAGTGAAAAGGG - Intergenic
992729534 5:79647554-79647576 TTATTAATATGCATGGATAATGG + Intronic
993783071 5:92093309-92093331 GCATTTGTTTGGATATATAATGG + Intergenic
995399400 5:111723124-111723146 GAATTTTGATGGATGGAGAAGGG - Intronic
996670943 5:126116581-126116603 ACATATATATGAATGGAGAAAGG + Intergenic
998815011 5:146004987-146005009 GTGTTTATATAAATGGATAAAGG + Intronic
999236235 5:150097910-150097932 AAATTTATATGGAAGCATAAAGG + Intronic
999519711 5:152338587-152338609 GCTTTTTTTTGGATGGATGATGG + Intergenic
1001392385 5:171389286-171389308 GCATGTATATGTATTGGTAACGG + Intronic
1001790331 5:174451481-174451503 CCATTTTTATGCATGGAAAAAGG - Intergenic
1002462930 5:179385103-179385125 GAATTTATGTGGAAGGATCAAGG - Intergenic
1003945443 6:11071317-11071339 GCATTTCCATAGATGGAGAAAGG - Intergenic
1004967278 6:20867952-20867974 ACATCTATATGGATGTATAGAGG + Intronic
1005429930 6:25745321-25745343 ACATATATATGTATGGATATAGG + Intergenic
1006482011 6:34303035-34303057 GCATTTATATGGATGGATAAAGG - Intronic
1007605308 6:43113780-43113802 GCATTTATCTTGATGAATAATGG + Intronic
1008657391 6:53629828-53629850 GTATTTGTTTGGATGGAGAATGG + Intergenic
1011104533 6:83765078-83765100 GCATTTAAGTGGATGGAAATGGG + Intergenic
1014034814 6:116753995-116754017 GGATTTTTATGGAAGGACAATGG + Intronic
1014970152 6:127804004-127804026 TCATGTATATGGATTCATAAAGG - Intronic
1015034770 6:128640363-128640385 CCATTTATATGTATGTATATGGG + Intergenic
1017081409 6:150672422-150672444 GCATTTATATTGTTTGATCATGG + Intronic
1018092898 6:160360907-160360929 ATATTTATATGGAAGAATAAAGG + Intronic
1022254446 7:28641845-28641867 TCGTTTTTATGGATGGATCATGG + Intronic
1023384572 7:39643197-39643219 GCATTTATATGGATGCTCAAAGG - Intronic
1024266579 7:47611375-47611397 GCATTTATATGGAGGCCTGAAGG + Intergenic
1029184527 7:98729085-98729107 GAATTTATTTGGATGAAAAATGG + Intergenic
1029910762 7:104144960-104144982 GCATGTATATGCATAAATAAGGG + Intronic
1030112702 7:106040163-106040185 TCATTTTTATGGCTGAATAATGG + Intergenic
1030873764 7:114788485-114788507 GCATATATATAGTAGGATAAAGG + Intergenic
1033619667 7:143050689-143050711 GCATTTATGGGGCTGGAGAAAGG + Intergenic
1033853304 7:145524839-145524861 GCATTTATTTGGGAGGATAGTGG - Intergenic
1039857294 8:41426803-41426825 ACTTTGAAATGGATGGATAATGG + Intergenic
1040034112 8:42851940-42851962 GCATTTAAATGGATGGATGGTGG + Intronic
1044122413 8:88413930-88413952 GTATTTTTGTGGACGGATAAAGG + Intergenic
1046647629 8:116803383-116803405 GCAATTAAATGGGTGGACAAGGG + Intronic
1048187856 8:132260774-132260796 ATAATTAAATGGATGGATAATGG - Intronic
1052435797 9:28427259-28427281 GCACTGCTATAGATGGATAATGG + Intronic
1052519561 9:29528182-29528204 TCATTTATATAGATTGAGAAAGG - Intergenic
1052617421 9:30858641-30858663 ACATATACATAGATGGATAACGG - Intergenic
1057484669 9:95473171-95473193 GCATTTAGGCAGATGGATAAAGG + Intronic
1057713466 9:97468264-97468286 GTATTTACATGGAGGCATAAGGG + Intronic
1202799033 9_KI270719v1_random:155991-156013 GGATGTATATGGATGTATATGGG - Intergenic
1186133431 X:6494237-6494259 GCATTAACATGGATGGAAACAGG - Intergenic
1187736520 X:22310557-22310579 GGATTCATATGGATGAAAAAAGG + Intergenic
1187847188 X:23552264-23552286 GCATGTATATGGGAGTATAAAGG - Intergenic
1188149879 X:26659650-26659672 ACATTTATAAGGATAGACAAAGG + Intergenic
1190895750 X:54616267-54616289 GCATTTATTTGGCAGGAGAAAGG + Intergenic
1190908212 X:54749044-54749066 GCACAGATATGGATGGATAGAGG - Exonic
1190996077 X:55610656-55610678 ACATATATATGGATATATAAAGG + Intergenic
1193486464 X:82090273-82090295 ATATTTATATGGATGGCTAATGG + Intergenic
1194221496 X:91199194-91199216 GCATTTAGAAAAATGGATAAAGG + Intergenic
1195219888 X:102736785-102736807 GGAAATATATGGATGGCTAATGG - Intronic
1195582512 X:106523549-106523571 GCATTTATTTGCATTAATAATGG - Intergenic
1196413691 X:115447572-115447594 AAATTTATATCGATGAATAAAGG + Intergenic
1200558007 Y:4662947-4662969 GCATTTAGAAAAATGGATAAAGG + Intergenic
1201616871 Y:15910207-15910229 GCATTAACATGGATGGAAACAGG - Intergenic