ID: 1006485533

View in Genome Browser
Species Human (GRCh38)
Location 6:34337986-34338008
Sequence GTGTGGTAGGGCCAGTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006485533_1006485539 21 Left 1006485533 6:34337986-34338008 CCCACCAACTGGCCCTACCACAC 0: 1
1: 0
2: 2
3: 4
4: 145
Right 1006485539 6:34338030-34338052 CAGTTCCTACAGAAAGAGTCAGG No data
1006485533_1006485541 27 Left 1006485533 6:34337986-34338008 CCCACCAACTGGCCCTACCACAC 0: 1
1: 0
2: 2
3: 4
4: 145
Right 1006485541 6:34338036-34338058 CTACAGAAAGAGTCAGGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006485533 Original CRISPR GTGTGGTAGGGCCAGTTGGT GGG (reversed) Intronic
907712926 1:56901128-56901150 GTGTGGCTGGGCTAGTTGGGAGG - Intronic
910396882 1:86802452-86802474 CAGTGGAAGGGCCAGTGGGTTGG + Intergenic
912116767 1:106416947-106416969 GAGTGGGAGAGTCAGTTGGTAGG + Intergenic
917782645 1:178414511-178414533 GTTTGGTAGGGCATGTTGGTGGG + Intronic
920285112 1:204873648-204873670 GTGTGCTAGGGACAGCTGCTGGG + Intronic
923717397 1:236436782-236436804 ATTTGGTTGGGACAGTTGGTTGG + Intronic
1068851251 10:61743961-61743983 GGGTGGTGGGGGCACTTGGTAGG - Intronic
1073495528 10:103887645-103887667 GTGTAGTAGTGCCAGGTGATTGG + Intronic
1077069670 11:662909-662931 GTGCGGCAGGGTCAGTTGGCTGG - Intronic
1077391979 11:2304438-2304460 GTGAGGTAGGGCCTGGTGGAGGG - Intronic
1077894076 11:6440811-6440833 GTAAGGTAGGGCCAGTTTTTAGG - Intronic
1078455133 11:11469026-11469048 GTTTGGTAGGGACAGTGTGTTGG + Intronic
1085297118 11:75437528-75437550 GGGGGGTGGGGCCAGGTGGTAGG + Intronic
1086248306 11:84782421-84782443 GTGTGGTAGGGGTAGTTAGTGGG - Intronic
1087821360 11:102716378-102716400 GTGTGCTTGGTCCAGTAGGTTGG + Exonic
1089335145 11:117717822-117717844 GTGTTTTAGTGCCAGTTGCTAGG - Intronic
1089726732 11:120487455-120487477 GTGTGGGAGGCCAAGTTGGGAGG - Exonic
1091497948 12:988951-988973 GTGTAGTTGGGCAAGTTGGCAGG - Intronic
1091952643 12:4607712-4607734 GTGTGAGAGGGCAAGTTGCTTGG - Intronic
1092504505 12:9082421-9082443 GTTTGGTAGGGCCACTGGTTGGG - Intronic
1096295964 12:50384297-50384319 GTGTGGTAGTCCTAGATGGTCGG + Intronic
1105822329 13:24090594-24090616 GTGGGGTAGGGACAGTGGGATGG - Intronic
1106439543 13:29753921-29753943 GGTGGGTAGGGCCAGTGGGTCGG + Intergenic
1107122038 13:36806604-36806626 CTCTGGTAGGGCAAGATGGTTGG + Intergenic
1107675650 13:42794022-42794044 GTGTGTTAGGGGCATGTGGTAGG - Intergenic
1107833391 13:44394261-44394283 GTGTGGTAGTGCCAGCTACTTGG - Intronic
1110965955 13:81697407-81697429 GGGTGGTAGGGCTGGTGGGTGGG + Intergenic
1113812836 13:113152990-113153012 GTGTGGCCGGGCCAGTGGGGAGG + Intergenic
1114617394 14:24075622-24075644 GTGTGGTAGGGGCAGGGGCTGGG - Intronic
1114809722 14:25883627-25883649 TTGTGGTAAGGGCACTTGGTGGG + Intergenic
1115252884 14:31368072-31368094 GGGAGGTAGGGCCTTTTGGTAGG + Intronic
1116632750 14:47355713-47355735 GTGGGGAAGGCCCAGGTGGTTGG - Intronic
1117687107 14:58265015-58265037 GTTTGGTAGGCCAAGTTGGGAGG + Intronic
1119531925 14:75368069-75368091 ATATGGGAGGGTCAGTTGGTTGG - Intergenic
1119745909 14:77043779-77043801 GGGTGGTTAGGCCAGTGGGTGGG + Intergenic
1121453742 14:94025721-94025743 GTGTGGGAGGGAGAGTTTGTAGG - Intergenic
1122878617 14:104680005-104680027 GGATGGTAGGGCCAGGTGGAGGG - Intergenic
1126181151 15:45786134-45786156 GTGTGGCAGGGCCATTTGTGAGG + Intergenic
1128228010 15:66015920-66015942 GTGGGGTAGTGGGAGTTGGTGGG + Intronic
1130060522 15:80566569-80566591 GTCTGGCAGGGCCAGGTGGGAGG - Intronic
1131015046 15:89050987-89051009 CTTTGGTAGGCCCAGGTGGTTGG + Intergenic
1132089068 15:98933106-98933128 GTGTGGTAGAGCCTGGTGGCAGG + Intronic
1133101458 16:3482633-3482655 GTGGGGTAGGGCAAGGGGGTGGG - Intronic
1133168336 16:3964648-3964670 GGGTGGCAGGGGCAGCTGGTGGG + Exonic
1134187990 16:12099418-12099440 GTGAGGAAGGGCCAGTGAGTTGG + Intronic
1135222475 16:20624854-20624876 GTGTGGTGGGGGCAGGTGGGTGG - Intronic
1136862758 16:33713003-33713025 CTGTGCTAGGGCCAGTGTGTGGG - Intergenic
1136994242 16:35177201-35177223 CTGTGGTGGTGTCAGTTGGTAGG - Intergenic
1138367265 16:56490517-56490539 GTGTGGTAGCGCTACTTGGGAGG + Intronic
1138412624 16:56851985-56852007 GTGTGGTAGGGTCAGTGGTGTGG - Intergenic
1138765232 16:59594474-59594496 GTGGGGTAGGGGGAGTAGGTGGG - Intergenic
1141029445 16:80574913-80574935 GTGTGCTAGGCCCTGTTGGAAGG - Intergenic
1141049639 16:80748702-80748724 GTGGTGTTGGGCCAGATGGTGGG - Intronic
1203124241 16_KI270728v1_random:1561162-1561184 CTGTGCTAGGGCCAGTGTGTGGG - Intergenic
1143282778 17:5767080-5767102 TTGGGTTAGGGCCAGTTTGTGGG + Intergenic
1148048415 17:44757993-44758015 GTGTGGTAGGGCATGGTGGGTGG - Intergenic
1148273173 17:46279789-46279811 GTGTAGGAGGGCCTGTTGGCTGG - Intronic
1149796627 17:59526955-59526977 TTGTTTTAGGGCCAGATGGTTGG + Intergenic
1151666021 17:75545516-75545538 GTGTGGTGGGGCCAGCAGGGTGG + Intronic
1151889986 17:76946222-76946244 GGGTGGAAGGGCCAGGTGGATGG + Intronic
1152148177 17:78581771-78581793 GTGTGGGAGGCCCAGGTGGGTGG + Intergenic
1152739903 17:82014305-82014327 GTGGGGTAGGGCCTGGTGGGTGG - Intronic
1158547633 18:58409658-58409680 GCGTGGTATGGCCTGCTGGTAGG + Intergenic
1159939898 18:74398784-74398806 GTGTGGTAGTGCTAGGAGGTGGG - Intergenic
1162108489 19:8386248-8386270 CAGTGGAAGGGCCAGTGGGTCGG - Intronic
926333176 2:11842320-11842342 GTGTGGTAGGGGCAGTGGTGTGG + Intergenic
928374798 2:30765530-30765552 GTGTGGAAGACCCAGTTGGAGGG - Intronic
930097020 2:47572520-47572542 CTGTGGTAGGGACAGATGGGTGG + Intergenic
930564452 2:53002112-53002134 GTGTGGTGGGGGCGGTTGGGAGG - Intergenic
931847720 2:66222065-66222087 GTGTGAGAGGGTCAGTTAGTAGG - Intergenic
933236449 2:79870171-79870193 GTGTGGTAGGGCTAGCAGGGTGG - Intronic
933277618 2:80300831-80300853 TGGTGGTAGTGGCAGTTGGTGGG - Intronic
933372046 2:81426981-81427003 GTTTGGAAGGGCCAGATGGGAGG - Intergenic
935466512 2:103404970-103404992 ATGTGGTAGGGCCAGTGACTTGG - Intergenic
937222567 2:120350240-120350262 GAGTGGCCGGGCCAGCTGGTGGG - Exonic
942524146 2:176835211-176835233 GGGAGGTAGGGACAGTTAGTGGG + Intergenic
943181463 2:184547797-184547819 ATTTGGGAGGCCCAGTTGGTTGG + Intergenic
944903503 2:204239753-204239775 GTGGGGTGGGGCCAGGGGGTGGG + Intergenic
948469002 2:238165541-238165563 GTGTCGTAGGTGAAGTTGGTGGG + Intronic
1175470496 20:59223716-59223738 GTGTGGTGAGGCCAGCTGGCTGG + Intronic
1179194311 21:39151291-39151313 CTGTGGGAGCGTCAGTTGGTAGG + Intergenic
1179667084 21:42920311-42920333 GGGTTGTAGGGCCATTTGTTTGG + Intergenic
1182090686 22:27592536-27592558 ATGTGGCAGGGCCTGTAGGTGGG + Intergenic
1185276407 22:49951825-49951847 CTGGGGCAGGGCCAGTTGGAAGG + Intergenic
949607050 3:5664671-5664693 TGGTGGTAGGGCCAGGTGGGAGG - Intergenic
949641948 3:6046423-6046445 CTGTGGCAGGCCCAGTTGTTGGG - Intergenic
950439474 3:13000734-13000756 CTGAAGGAGGGCCAGTTGGTGGG + Intronic
952205737 3:31180647-31180669 GTGTAGTAGGGCCCCTGGGTGGG + Intergenic
954111783 3:48437650-48437672 TTGAGGAAGGGGCAGTTGGTAGG - Intronic
954213051 3:49109065-49109087 GTGTGGTAGGGCCACGTGGTAGG + Exonic
954784143 3:53080913-53080935 GTGTGGTGGGGCCAGGAGTTTGG - Intronic
957570736 3:81945099-81945121 GTTGGGTAGGGCCACTGGGTAGG + Intergenic
957888907 3:86329567-86329589 TTGTGGTAGGGCCAGGAAGTAGG - Intergenic
959512502 3:107230087-107230109 GTGTAGCAGGGCCACTTGGTGGG + Intergenic
961454956 3:127019408-127019430 GTGTGTTGGGGCCAGGTGGGAGG + Intronic
961531318 3:127542143-127542165 CTGTGGAAGGGCCAGGTGCTGGG - Intergenic
962844916 3:139265741-139265763 GAGTGGTGGGGCCAGTGGGATGG + Intronic
963612262 3:147485089-147485111 GTGGGGTAGGGGCAGGGGGTAGG - Intronic
966565702 3:181378423-181378445 GTGTGGTAGGCCCAGCCGGGTGG - Intergenic
968482335 4:839811-839833 GTGTGGTAGTGTCAGGAGGTGGG - Intergenic
973150711 4:46884162-46884184 GTGTGAGGGGGCCAGTTGGGGGG + Intronic
977310560 4:95381911-95381933 GTGTGTATGGGGCAGTTGGTGGG + Intronic
984100207 4:175475494-175475516 GTGGGGTAGGGGGAGTGGGTAGG - Intergenic
985273235 4:188214368-188214390 GTGTGTTAGTCCCACTTGGTTGG + Intergenic
985718234 5:1474802-1474824 CAGGGGAAGGGCCAGTTGGTGGG + Intronic
992933815 5:81680071-81680093 GGGTGGCAGGGCCAGGTGTTGGG - Intronic
992987986 5:82253343-82253365 GCATTGTAGGGCCAGTTGTTGGG + Exonic
994559335 5:101347200-101347222 GTGTGGTTGTGTCAGTTGGTTGG - Intergenic
996514517 5:124355023-124355045 GTGTGGTAAGGCCAGGTGCCTGG - Intergenic
999480638 5:151944972-151944994 ATGTGGTAGGATTAGTTGGTTGG - Intergenic
999518190 5:152321964-152321986 GTGTGGCAGGGTAAGTGGGTGGG + Intergenic
1002463259 5:179387434-179387456 GAGGGGCAGGGCCACTTGGTTGG + Intergenic
1006026318 6:31149311-31149333 GAGTGGCATGGTCAGTTGGTGGG - Intronic
1006485533 6:34337986-34338008 GTGTGGTAGGGCCAGTTGGTGGG - Intronic
1006742509 6:36319660-36319682 TTGTGGGAGGGGCAGTTGGCGGG - Intronic
1007655583 6:43449333-43449355 CTGTGGTAGGGGCTGTTGCTTGG + Intronic
1008941432 6:57050012-57050034 ATGAGGTAGGGCCAGGGGGTGGG + Intronic
1009939036 6:70268175-70268197 GAGTGGTGGGGGCAGTTGGAGGG - Intronic
1013431868 6:110063009-110063031 GTGTGTTAGGTCCAGTTCCTGGG - Intergenic
1020104793 7:5417724-5417746 ATCTGGAAGGGCCACTTGGTGGG - Intronic
1021630877 7:22646431-22646453 GTGTGGGAACGCCAGTTGGGTGG + Intergenic
1022112744 7:27241374-27241396 GTGTGCTGGGGCCAGGTGGGTGG - Intergenic
1023720065 7:43083981-43084003 GTGGGGAAGAGCCAGTTGCTGGG + Intergenic
1024574599 7:50753652-50753674 GTGTGGTGGCTCCATTTGGTGGG - Intronic
1024749232 7:52445540-52445562 GAGTGGTAGGGCCTGGTGCTGGG + Intergenic
1024933518 7:54689351-54689373 GTCTGGTAGGGCCCTGTGGTGGG - Intergenic
1027352011 7:77321654-77321676 GAGTGGTGGGGCCAGTTAGCTGG - Intronic
1029290693 7:99500189-99500211 GTGTGGTGGGGCCCGGTGTTTGG - Exonic
1032086417 7:128886336-128886358 GTATGCAAGGGCCAGTTGTTGGG + Intronic
1033278686 7:139990802-139990824 GAGGGGTGGGGCCAGCTGGTTGG - Intronic
1034720224 7:153285399-153285421 GGGTGGGAGGAGCAGTTGGTTGG + Intergenic
1034851398 7:154497362-154497384 CTTTGGGAGGCCCAGTTGGTTGG + Intronic
1040988112 8:53318478-53318500 GGGTGGGAGGGCCAGTTTTTTGG + Intergenic
1042194600 8:66221542-66221564 GTGTTGAAGGACCAGCTGGTGGG - Intergenic
1045336945 8:101213728-101213750 GTGTGGTGGGGACAAGTGGTGGG + Intergenic
1046084116 8:109410605-109410627 GTGAGGTAGGGCCTGTTGGTAGG - Intronic
1047209724 8:122831598-122831620 GGGTTGTAGGGCCACTTGTTTGG + Intronic
1048662570 8:136622026-136622048 GTGTGGTAGGGAGAGGTGGAGGG - Intergenic
1049319583 8:141988859-141988881 GAGTGGGAGGGCCACTTGGCTGG - Intergenic
1052056931 9:23917144-23917166 CAGTGGAAGGGCCAGTGGGTCGG + Intergenic
1056277610 9:85008413-85008435 TTGTGGCAGGGACTGTTGGTTGG - Intronic
1057945285 9:99322477-99322499 GTCTGATAGGGCCAGATGATTGG - Intergenic
1186938051 X:14472840-14472862 GTGTGTTAGGGAATGTTGGTGGG + Intergenic
1189491837 X:41476025-41476047 GTTTGGTAGGGCCCCTAGGTGGG - Intergenic
1190382039 X:49848446-49848468 GGGTGGTAGGGCCTGGTGGGAGG - Intergenic
1191694518 X:63976722-63976744 GGGTGGGAGGGGCAATTGGTGGG - Intergenic
1192166451 X:68830078-68830100 GTGGGGTAGGGGCACTTGGCTGG + Intronic
1195583392 X:106533264-106533286 GTCAGGTAGGGCCACTTGCTAGG - Intergenic
1195951119 X:110274251-110274273 GTCAGTTAGGTCCAGTTGGTTGG + Intronic
1199479772 X:148285455-148285477 TTCTGGTAGGGCCAGGTGCTAGG + Intergenic
1201059774 Y:10035721-10035743 GTGGGGTAGGGCGAGTGCGTTGG + Intergenic
1201541145 Y:15106302-15106324 GTGGGGTAGGGCGAGGTGGAGGG - Intergenic