ID: 1006491942

View in Genome Browser
Species Human (GRCh38)
Location 6:34395105-34395127
Sequence GAGGCTTAACTAAAGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006491942 Original CRISPR GAGGCTTAACTAAAGGAGGC TGG Intronic
900167075 1:1248105-1248127 GAGGCTGGACTGAGGGAGGCTGG + Intergenic
900167158 1:1248368-1248390 GAGGCTGGACCAAGGGAGGCTGG + Intergenic
900167218 1:1248566-1248588 GAGGCTGGACCAAGGGAGGCTGG + Intergenic
903166357 1:21523413-21523435 GAGTCTTTACAGAAGGAGGCAGG - Intronic
904459939 1:30670612-30670634 CAGGCATAACTCCAGGAGGCAGG - Intergenic
911370177 1:96986990-96987012 GAGGCTAGAATAAAGCAGGCAGG + Intergenic
911383068 1:97140164-97140186 GAGGGTTAAAGTAAGGAGGCTGG + Intronic
911921056 1:103761613-103761635 GGGCCATAACTAGAGGAGGCAGG - Intergenic
913306661 1:117435319-117435341 GAGGATAAACCAAAGGAAGCAGG + Intronic
914434558 1:147648473-147648495 GTGTCTTACGTAAAGGAGGCAGG - Intronic
916750257 1:167716949-167716971 GAGGCTTATCATAAGGAAGCTGG + Intergenic
916873466 1:168942244-168942266 GAGGCTAATCTGAGGGAGGCTGG - Intergenic
919898257 1:202023305-202023327 GAGGATTGACCAAAGGATGCTGG - Intergenic
920495491 1:206451868-206451890 GAGATTTCACTATAGGAGGCTGG - Intronic
924946219 1:248848650-248848672 GAGGCTTCTCTAAAGGTGGTTGG + Exonic
1063448205 10:6133548-6133570 GAGGCCAAACTAAACCAGGCGGG - Intergenic
1063827140 10:9910797-9910819 GAGGCTAGAATAAAGCAGGCAGG - Intergenic
1064883194 10:20080604-20080626 GAGGCTAGAATAAAGCAGGCAGG - Intronic
1065491203 10:26283591-26283613 GTGGTTTAACTAGAGGAGGGTGG - Intronic
1066217953 10:33306253-33306275 CTGGCTTAAATAAAAGAGGCAGG + Intronic
1070776390 10:79112321-79112343 GAGGCTGAACTAAAGGGAGGGGG + Intronic
1071183986 10:83019501-83019523 GAGGCTTAACTCTAGGAGGAAGG + Intergenic
1072375767 10:94814079-94814101 GAGGCTAAACTGAAGCAGGGAGG - Intronic
1072389643 10:94969730-94969752 GAGGCTAAACTGAAGCAGGGAGG - Intronic
1072405007 10:95142840-95142862 GAGGAATAACTAATGGATGCTGG + Intergenic
1075265290 10:120995883-120995905 GAGGCTTATCTAAAGGAACTTGG - Intergenic
1079402028 11:20113467-20113489 GAGGCTTAAGAAAAGGAGCTTGG + Intronic
1081631654 11:44693786-44693808 GTGGCTTAAGTGAAGAAGGCAGG + Intergenic
1084761259 11:71272597-71272619 CAGGCCTAACTCAAGGAGGCAGG + Intergenic
1084906614 11:72353264-72353286 GAGGATTCACTAAAGTAGGTGGG + Intronic
1086010485 11:82097303-82097325 TAGGCTTAAAAATAGGAGGCAGG + Intergenic
1087557886 11:99745688-99745710 AAGGCTTAACTAAGGTTGGCAGG - Intronic
1090494723 11:127199406-127199428 GAGGCTGAACTCAAGGCGACTGG - Intergenic
1091921362 12:4307635-4307657 GAGGCTTAAAGAAAGAAGGCTGG + Intergenic
1100234233 12:92642607-92642629 GAGTGATAACTAAAGGATGCAGG + Intergenic
1101823366 12:108201396-108201418 GAGGCTAAACTGGAGTAGGCTGG - Intronic
1105584797 13:21733968-21733990 GAAGCTTAACTGAGGGAAGCTGG - Intergenic
1108558178 13:51616716-51616738 GTGGCTAAATTTAAGGAGGCTGG + Intronic
1110836842 13:80093417-80093439 GAGACGTTACTCAAGGAGGCTGG + Intergenic
1111828723 13:93300350-93300372 GAGGTTTAAGAATAGGAGGCTGG + Intronic
1113195583 13:107801412-107801434 GAGCAATTACTAAAGGAGGCTGG + Intronic
1114484520 14:23054951-23054973 GAGGCTGAATTGAAGGGGGCAGG + Intronic
1115818399 14:37187906-37187928 GAGGGTTAACCAAAGGAGGATGG + Intergenic
1118935229 14:70282102-70282124 GGGGCTTAACAAGAGGAAGCTGG - Intergenic
1121889092 14:97572507-97572529 AAGGGTTAAGTAAATGAGGCAGG - Intergenic
1124793141 15:32749138-32749160 GAAGATTAATTAAAGGAGACTGG - Intergenic
1128412371 15:67412493-67412515 GAGGCTTGAATCCAGGAGGCAGG - Intronic
1131368846 15:91862899-91862921 GAGGCTTATGTAAAATAGGCAGG + Intronic
1131585824 15:93691699-93691721 GAGGATTAACTGAGGGAGGAGGG + Intergenic
1139461100 16:67123178-67123200 GTGGCAAAACTAAAGGAGGAAGG - Intronic
1144888719 17:18481295-18481317 AAGGCTTAACTAAGGAAGCCAGG - Intronic
1145143488 17:20463003-20463025 AAGGCTTAACTAAGGAAGCCAGG + Intronic
1146289320 17:31596670-31596692 GAGGCTTAAAGAAACGGGGCTGG - Intergenic
1146635333 17:34499920-34499942 GAGAATAAACTAAAGGGGGCAGG - Intergenic
1147111981 17:38269657-38269679 GAAGCCTGACTAATGGAGGCTGG - Intergenic
1148417594 17:47519143-47519165 GAAGCCTGACTAATGGAGGCTGG + Intergenic
1151855105 17:76715436-76715458 GTGGCTTTACTCTAGGAGGCTGG - Exonic
1153134007 18:1892368-1892390 GAGGCTTATCCAAAGGAAACAGG + Intergenic
1153932203 18:9887857-9887879 GAGGCATCACTGAAGGAGGCCGG + Exonic
1158886364 18:61830659-61830681 GAGGCTGAACTAAAGGAAAGAGG + Intronic
1161381692 19:3968866-3968888 GAGGCTCTACAAAAGGAGGCAGG + Intronic
1164410019 19:27994380-27994402 GCAGCATAACTGAAGGAGGCAGG + Intergenic
1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG + Intronic
928171725 2:29008755-29008777 GAGGTTTAAATAAAATAGGCTGG - Intronic
931407544 2:61994543-61994565 GAGTCTTGACTAAAAGAGGGTGG - Intronic
939847985 2:147270683-147270705 GAGCCTTAAGTAAAAGAGACAGG + Intergenic
941088450 2:161146648-161146670 GAGACATCACTCAAGGAGGCTGG + Intronic
942064623 2:172258905-172258927 CATGTTTAACAAAAGGAGGCGGG + Intergenic
943400328 2:187401263-187401285 GTCTCTTAACTAAAGAAGGCAGG - Intronic
945772067 2:214056209-214056231 CAGGCTTGAATAAAGGATGCAGG - Intronic
946289440 2:218732773-218732795 GAGGCCTAACTAAAGCATTCAGG - Intronic
947750258 2:232528408-232528430 GAGGCTTAAGGAAAGGAGGCAGG - Intronic
1169266450 20:4170136-4170158 GAGGCTCACATAGAGGAGGCGGG + Intronic
1170478324 20:16739359-16739381 GAGGCTTAAAAAAAAAAGGCTGG - Intronic
1172828761 20:37813797-37813819 GAGAAATAACTAAAGGAGTCTGG - Intronic
1181295504 22:21835201-21835223 GAGGCTGAACTGAGGGAGGAAGG + Intronic
1181615231 22:24049714-24049736 CAGTCTTAACAAAAGGAGCCTGG - Intronic
1181884597 22:26010254-26010276 GAGGATGGACTAAAGGAGGGTGG - Intronic
1182360291 22:29742516-29742538 CAGGCTCCACCAAAGGAGGCAGG + Intronic
1184406006 22:44301205-44301227 GAGACTTAATCAAAGGAGGACGG + Intronic
1185327362 22:50233485-50233507 GAGCCTTACCTGACGGAGGCGGG - Exonic
949807626 3:7973386-7973408 GAGCCTATGCTAAAGGAGGCTGG + Intergenic
950043444 3:9934377-9934399 GAGGCTTCACTGAAGGAGTCAGG - Intronic
951582425 3:24180227-24180249 GAGGCTTAACTAAAATAGTATGG + Intronic
951617705 3:24566884-24566906 GAGGGTGAACTGAAGCAGGCGGG + Intergenic
954992199 3:54851252-54851274 GAGGCTTAAGGAAAGGATGAAGG + Intronic
960111951 3:113853857-113853879 GAGGCTTAAATGATGGGGGCGGG + Intronic
961498841 3:127316019-127316041 GAGGCTAAGCTAAAGGACTCTGG - Intergenic
966885340 3:184374712-184374734 GAGGCTTAAATGATGGAAGCAGG + Intronic
967735093 3:192943361-192943383 GAGACTTAGAAAAAGGAGGCTGG + Intergenic
967818663 3:193819797-193819819 GAAGCTTGACTGAAGAAGGCAGG - Intergenic
968685272 4:1953732-1953754 GATGCTTAACTATAGGAGAGGGG + Intronic
969170927 4:5362717-5362739 GAGGCATACCCAAAGAAGGCTGG + Intronic
970652949 4:18198330-18198352 GACACTTAACTATAGGAGGGAGG - Intergenic
974420916 4:61672285-61672307 GACTCTTCAATAAAGGAGGCTGG - Intronic
974768748 4:66383345-66383367 GAGGTGTCACTCAAGGAGGCTGG - Intergenic
979187106 4:117810822-117810844 GGGGCTGAACGACAGGAGGCAGG - Intergenic
985342038 4:188964864-188964886 GATGATTAAATAATGGAGGCAGG + Intergenic
986241426 5:5963417-5963439 GAGGGTGAACTGAAGCAGGCAGG + Intergenic
986579345 5:9248748-9248770 GAGCCTCAAGTCAAGGAGGCCGG + Intronic
989251405 5:39319740-39319762 GAGGCTGAACTCATGAAGGCTGG - Intronic
990086614 5:51986605-51986627 GTGGCTTAAGTAAAGGATGGAGG + Intergenic
991293843 5:65060562-65060584 GATGATTAAATAAAGGAGGTGGG + Intergenic
998465313 5:142339098-142339120 GAGGCTTAAATACATGAGCCAGG - Intergenic
998789694 5:145752764-145752786 GAGGCTTACAGAAAGCAGGCAGG - Intronic
1002922602 6:1583260-1583282 GACTTTTAAATAAAGGAGGCCGG + Intergenic
1003848349 6:10197032-10197054 GAGGCTGTAATAAAGGAGACTGG - Intronic
1006278104 6:33022221-33022243 GAGGGTGAACTAGAGGAGGTGGG - Intergenic
1006491942 6:34395105-34395127 GAGGCTTAACTAAAGGAGGCTGG + Intronic
1007177112 6:39904472-39904494 GAAACTTATCTAAAGGTGGCAGG - Exonic
1008764434 6:54894098-54894120 GAGGCTTAACTTAAGGATGAGGG + Intronic
1012630305 6:101458490-101458512 GAGGCTGCACTGCAGGAGGCTGG - Intronic
1013461611 6:110379390-110379412 GAGACGTCACTCAAGGAGGCTGG - Intergenic
1015859091 6:137656675-137656697 GAGGCCTATCTAAGGGAGCCTGG - Intergenic
1017088849 6:150740394-150740416 GATGCTGGACTAAAAGAGGCAGG + Intronic
1018410573 6:163542241-163542263 GAGGATTAACGGAAGGAGGAAGG - Intronic
1019529776 7:1497553-1497575 GAGGATTAATTAACGGAAGCTGG + Intronic
1022840824 7:34162219-34162241 GAGGCTTCTCTTCAGGAGGCGGG - Intergenic
1025823302 7:64991593-64991615 GAGGCATAACTATAGGAGATTGG - Exonic
1028045640 7:86115368-86115390 GAAGCTTCATTAAAGGAGACTGG - Intergenic
1029306018 7:99620585-99620607 GAGGCTGAACTACAGAAGGACGG - Intronic
1029893603 7:103958108-103958130 AAGGATTAACTAAAGCAGGATGG + Intronic
1035425078 7:158765214-158765236 CATGCTTATCTCAAGGAGGCTGG + Intronic
1037687997 8:21159690-21159712 AATGCTTAAGGAAAGGAGGCAGG + Intergenic
1045050665 8:98321259-98321281 GAGGCCAAAGCAAAGGAGGCAGG - Intergenic
1050622776 9:7472281-7472303 TAGGCTGAGCTAGAGGAGGCTGG + Intergenic
1051682273 9:19619461-19619483 GAAGCTAAACAAGAGGAGGCTGG + Intronic
1052371825 9:27674258-27674280 GAGGATTCAGTAAAGGAGGGGGG - Intergenic
1053619663 9:39802517-39802539 GAGCCTTTACTAAAGCAGTCTGG + Intergenic
1053877835 9:42561833-42561855 GAGCCTTTACTAAAGCAGTCTGG + Intergenic
1053894819 9:42732533-42732555 GAGCCTTTACTAAAGCAGTCTGG - Intergenic
1054233860 9:62539861-62539883 GAGCCTTTACTAAAGCAGTCTGG - Intergenic
1054264495 9:62904926-62904948 GAGCCTTTACTAAAGCAGTCTGG - Intergenic
1054894642 9:70295011-70295033 GGGGCTCAATTAAAGGAGGAAGG + Intronic
1055592169 9:77828439-77828461 AAGGCTTAATTACAGGAGGATGG - Intronic
1055920903 9:81459856-81459878 TAGGCTTATCTAATGGAGCCAGG - Intergenic
1058189618 9:101897070-101897092 GAGGCTGACCTAGAGGAGGTGGG + Intergenic
1058748200 9:108012722-108012744 GTGGGTTAAGTGAAGGAGGCAGG - Intergenic
1058802446 9:108557896-108557918 GAGGTGTCATTAAAGGAGGCTGG - Intergenic
1189101721 X:38197351-38197373 GAGGCTAAACCAAAGAAGTCTGG + Intronic
1189629732 X:42940317-42940339 GAGGCTTAACTTAAAGAATCTGG + Intergenic
1192232156 X:69272857-69272879 GAGGCTTTTCTAGAGGAGCCGGG - Intergenic
1194489762 X:94531202-94531224 GAGATGTCACTAAAGGAGGCTGG - Intergenic
1196607261 X:117671321-117671343 GAGACGTCACTCAAGGAGGCTGG + Intergenic
1197046391 X:122003668-122003690 GAGACGTCACTCAAGGAGGCTGG + Intergenic
1197187234 X:123601410-123601432 GAGGCTTAGTCAAAGGAGGTAGG + Intronic
1199602665 X:149551793-149551815 CAGGCTTAGCCAGAGGAGGCTGG - Intergenic
1199647723 X:149927682-149927704 CAGGCTTAGCCAGAGGAGGCTGG + Intergenic
1199737269 X:150695785-150695807 GAGGCTTAAATTCATGAGGCAGG + Intronic