ID: 1006494553

View in Genome Browser
Species Human (GRCh38)
Location 6:34412743-34412765
Sequence GTGAACAATACGAAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 99}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006494553_1006494558 -3 Left 1006494553 6:34412743-34412765 CCTCCCACCTTCGTATTGTTCAC 0: 1
1: 0
2: 0
3: 6
4: 99
Right 1006494558 6:34412763-34412785 CACTGGCTCATGATCACCTGTGG 0: 1
1: 0
2: 2
3: 16
4: 156
1006494553_1006494559 -2 Left 1006494553 6:34412743-34412765 CCTCCCACCTTCGTATTGTTCAC 0: 1
1: 0
2: 0
3: 6
4: 99
Right 1006494559 6:34412764-34412786 ACTGGCTCATGATCACCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006494553 Original CRISPR GTGAACAATACGAAGGTGGG AGG (reversed) Intronic
905257142 1:36692155-36692177 GAGAACAATATGGAGGTGAGGGG - Intergenic
905386430 1:37607363-37607385 GTGAACAGTGATAAGGTGGGAGG - Intergenic
910496388 1:87833462-87833484 ATGAAAAATACGGGGGTGGGGGG + Intergenic
917670647 1:177270480-177270502 ATGAACAAGATGATGGTGGGGGG + Intronic
918096686 1:181341902-181341924 GTGAACAAGATAAAGGTGGGAGG + Intergenic
919364927 1:196647452-196647474 GTGAAGAATAGGAAAGTGTGGGG - Intergenic
1063873409 10:10445032-10445054 GTGAACATTACGAAAGTGGCAGG - Intergenic
1070112529 10:73498881-73498903 ATGAACAATGGGAGGGTGGGAGG + Exonic
1071387303 10:85134318-85134340 GTGAACAAAACAAAGGTGCAAGG - Intergenic
1071522736 10:86341135-86341157 CTGAACAATAAGGAGGAGGGAGG - Intronic
1072522703 10:96242523-96242545 GTGACCAATAAATAGGTGGGTGG + Intronic
1072552114 10:96487008-96487030 GTGAACAATACGAAGACTGCAGG - Intronic
1072872215 10:99132588-99132610 GAGAGCAAGACGAAGGAGGGTGG + Intronic
1079428830 11:20369094-20369116 GTGTACAATATAAAGTTGGGAGG + Intronic
1083224814 11:61278203-61278225 GTGTAAAACACGAAGGTTGGTGG - Intronic
1084977426 11:72809942-72809964 CTGATCAATATGAAGGTGTGAGG + Intergenic
1086170003 11:83825645-83825667 GTGAACAAGATGGAGGTAGGAGG + Intronic
1088764496 11:112962583-112962605 GTGAACAATAGGGAGCTGGGAGG + Intronic
1089157346 11:116412698-116412720 GTAAACAAGACGGTGGTGGGAGG - Intergenic
1093851059 12:24038719-24038741 GTGAATAATACGAAGTTGAAAGG - Intergenic
1094140640 12:27178303-27178325 ATGAACAAAAAGAAGGTTGGAGG - Intergenic
1096058357 12:48674680-48674702 GTGCACAAGGCCAAGGTGGGTGG + Intronic
1100500770 12:95172022-95172044 GGGAACAATTCTAAGGGGGGGGG + Intronic
1101542613 12:105678544-105678566 GTGACCACTAGGAAGGAGGGTGG + Intergenic
1105046409 12:133007541-133007563 GTGAGAAAGAGGAAGGTGGGAGG + Intronic
1108379283 13:49841090-49841112 GTGAACCATAAGAATATGGGAGG + Intergenic
1109277406 13:60317861-60317883 GGGAACAAGACCAAGGTGTGAGG + Intergenic
1114352299 14:21866447-21866469 GGAAACAATACGAAGGAGGAAGG - Intergenic
1115199899 14:30841652-30841674 GTGTACATTAAGAAGCTGGGTGG - Intergenic
1116147347 14:41091525-41091547 ATGAATAATAATAAGGTGGGAGG - Intergenic
1116525543 14:45899864-45899886 ATGGACAAAATGAAGGTGGGAGG + Intergenic
1116866851 14:50038297-50038319 GTGAACAAGAGTCAGGTGGGCGG - Intergenic
1128580751 15:68808004-68808026 GTGAACAATCCCATGGTGGTGGG + Intronic
1129115265 15:73362074-73362096 GTGAACAGGAAGAAGCTGGGTGG - Intronic
1133647740 16:7780288-7780310 GTTGACAAAACGAAGGAGGGTGG + Intergenic
1138423169 16:56912986-56913008 GTGAGCAAGGCGAGGGTGGGAGG + Intronic
1139914799 16:70421351-70421373 GTGAGAAAAACGAAGGTTGGGGG + Intronic
1144333628 17:14248764-14248786 GTAACCAAGAAGAAGGTGGGAGG - Intergenic
1147458604 17:40554206-40554228 GTGAAGAAAACGATGGAGGGAGG + Exonic
1148434411 17:47671320-47671342 CTGAACAATTCTAAGGTAGGTGG - Intronic
1149309373 17:55379099-55379121 GTGAAAAATACGATGGCGTGAGG + Intergenic
1150014280 17:61538122-61538144 ATGAATAATAAGAAAGTGGGAGG + Intergenic
1157371209 18:47113927-47113949 GTGGACAATGAGACGGTGGGGGG + Intronic
1158069671 18:53456077-53456099 GTGATCAATGCCAAGGTGAGTGG + Intronic
1163401740 19:17098052-17098074 GTGAAGAAAAAAAAGGTGGGGGG - Intronic
925511872 2:4636811-4636833 GGGAACAACATGAAGGAGGGAGG - Intergenic
929000264 2:37341533-37341555 GTGAAAAATACTAAGATGGCTGG + Intergenic
929481781 2:42315092-42315114 ATGGACAATATGAAGGTGTGAGG - Intronic
929675302 2:43920842-43920864 CTAAACAATAAAAAGGTGGGTGG + Intronic
930392385 2:50778547-50778569 ATGAACAAAAGGAAGGTGGCAGG + Intronic
931221306 2:60290617-60290639 GGGAACTAAAGGAAGGTGGGTGG + Intergenic
932160843 2:69458168-69458190 GTGAACAAGAGAAAGGAGGGGGG - Intronic
935039150 2:99409479-99409501 GTGACCAATATGAAGATGTGTGG - Intronic
936000599 2:108825153-108825175 GTAAATAATAGGGAGGTGGGAGG + Intronic
940992730 2:160114499-160114521 GTGAAAAATACAAAGCAGGGGGG + Intronic
945929022 2:215836317-215836339 GTAAACAAAACCAAGGTGGGTGG - Intergenic
946865974 2:224040938-224040960 GGGAACAATTCAAAGGAGGGGGG + Intergenic
1172772902 20:37392035-37392057 GTGTACAACAAGGAGGTGGGTGG + Intronic
1175414352 20:58792077-58792099 GGGAACAAAAGGAAGGTAGGAGG - Intergenic
1180186112 21:46140162-46140184 GTGAGCAATGTGAAGGTGGACGG - Intronic
1180186131 21:46140262-46140284 GTGAACAATGTGAAGGTGGACGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1182719719 22:32387292-32387314 GTGAACAAAATGGAGGTAGGTGG - Intergenic
1183482126 22:38070877-38070899 CTGAGCTATACAAAGGTGGGTGG + Exonic
1183846305 22:40543887-40543909 TTGAACAAGAACAAGGTGGGAGG + Intronic
962255965 3:133870470-133870492 GTGAACAATGCAGAGGTGGTGGG + Intronic
962982254 3:140501147-140501169 GAGAACAAGAGCAAGGTGGGTGG - Intronic
964074535 3:152677200-152677222 GGGAACAATACAAAGGAGGATGG + Intergenic
966716915 3:183021959-183021981 GTGGACAGTAGGAAGGTGGATGG - Intronic
968265105 3:197356679-197356701 GTGAAGAACACAGAGGTGGGTGG + Intergenic
971167705 4:24201406-24201428 GTGAACAACACCCAGGTGGAGGG - Intergenic
974019531 4:56680412-56680434 GAGAACAAAACGAAGGTGCTGGG - Intronic
975147993 4:70991497-70991519 TTGAAAAATACAAATGTGGGAGG - Intronic
987291676 5:16514238-16514260 GTTAAAAATAAGAATGTGGGAGG - Intronic
987356425 5:17067162-17067184 ATGTGCAATACGAAGGTGGTAGG + Intronic
987694490 5:21310560-21310582 GTGAAGAATAGGAAAGGGGGAGG - Intergenic
989329036 5:40234141-40234163 GTTAAAAATACAAAGATGGGAGG - Intergenic
991745750 5:69738911-69738933 GTGAAGAATAGGAAAGGGGGAGG + Intergenic
991751956 5:69816322-69816344 GTGAAGAATAGGAAAGGGGGAGG - Intergenic
991797350 5:70318869-70318891 GTGAAGAATAGGAAAGGGGGAGG + Intergenic
991825128 5:70614225-70614247 GTGAAGAATAGGAAAGGGGGAGG + Intergenic
991831243 5:70691223-70691245 GTGAAGAATAGGAAAGGGGGAGG - Intergenic
991889694 5:71318196-71318218 GTGAAGAATAGGAAAGGGGGAGG + Intergenic
995039182 5:107568986-107569008 GTCAACAGAACCAAGGTGGGAGG - Intronic
1003751799 6:9066856-9066878 GAGAACAGTACGAGGGTTGGGGG - Intergenic
1004022232 6:11786435-11786457 GTGCACATTACGAGGGTAGGTGG - Intronic
1004049364 6:12060058-12060080 GTGAACAATATAAACGTGGTGGG - Intronic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1007822624 6:44571846-44571868 GGGAATAAGACAAAGGTGGGTGG + Intergenic
1010377008 6:75182363-75182385 GGGACCTATAGGAAGGTGGGGGG - Intronic
1011650497 6:89502030-89502052 GTTAACAATAAGAATATGGGAGG - Intronic
1027361144 7:77411816-77411838 GTGAAGAATACTAAGGTGAGGGG + Intronic
1027998213 7:85454528-85454550 CTGAACAATAGGAAGGCTGGGGG - Intergenic
1031988343 7:128178484-128178506 GTGAGCAGAATGAAGGTGGGTGG + Intergenic
1034240893 7:149609939-149609961 TTGAAAAATACGTAGGTGTGTGG - Intergenic
1035247922 7:157576940-157576962 GTTAACACTGGGAAGGTGGGAGG - Intronic
1055395823 9:75873943-75873965 GAGGACAGTACCAAGGTGGGTGG + Intergenic
1059714471 9:116900777-116900799 GAGAACCAAACGAAGGTGGAGGG - Intronic
1060678569 9:125540193-125540215 GTGAAAAATCAGAAGGTGGTAGG - Intronic
1062049044 9:134437837-134437859 GTGGACAATACCAGGCTGGGTGG - Intronic
1190823300 X:53994456-53994478 TTGAATAAGATGAAGGTGGGAGG - Intronic
1193189159 X:78548964-78548986 CTGAACAATAGGAAAGTGGCAGG + Intergenic
1193947371 X:87755089-87755111 GTTAACAGTACCAAGGTTGGTGG + Intergenic
1196376449 X:115038397-115038419 GTAAAAAACAGGAAGGTGGGTGG + Intergenic
1200316944 X:155144311-155144333 GTGAACAATAGGTAGGTTTGTGG + Intronic