ID: 1006494558

View in Genome Browser
Species Human (GRCh38)
Location 6:34412763-34412785
Sequence CACTGGCTCATGATCACCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 156}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006494546_1006494558 20 Left 1006494546 6:34412720-34412742 CCCCTTTCCCCGTCCACTGTGTG 0: 1
1: 0
2: 0
3: 22
4: 234
Right 1006494558 6:34412763-34412785 CACTGGCTCATGATCACCTGTGG 0: 1
1: 0
2: 2
3: 16
4: 156
1006494547_1006494558 19 Left 1006494547 6:34412721-34412743 CCCTTTCCCCGTCCACTGTGTGC 0: 1
1: 0
2: 0
3: 33
4: 193
Right 1006494558 6:34412763-34412785 CACTGGCTCATGATCACCTGTGG 0: 1
1: 0
2: 2
3: 16
4: 156
1006494556_1006494558 -7 Left 1006494556 6:34412747-34412769 CCACCTTCGTATTGTTCACTGGC 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1006494558 6:34412763-34412785 CACTGGCTCATGATCACCTGTGG 0: 1
1: 0
2: 2
3: 16
4: 156
1006494552_1006494558 7 Left 1006494552 6:34412733-34412755 CCACTGTGTGCCTCCCACCTTCG 0: 1
1: 0
2: 0
3: 27
4: 271
Right 1006494558 6:34412763-34412785 CACTGGCTCATGATCACCTGTGG 0: 1
1: 0
2: 2
3: 16
4: 156
1006494551_1006494558 11 Left 1006494551 6:34412729-34412751 CCGTCCACTGTGTGCCTCCCACC 0: 1
1: 0
2: 14
3: 195
4: 1653
Right 1006494558 6:34412763-34412785 CACTGGCTCATGATCACCTGTGG 0: 1
1: 0
2: 2
3: 16
4: 156
1006494549_1006494558 13 Left 1006494549 6:34412727-34412749 CCCCGTCCACTGTGTGCCTCCCA 0: 1
1: 0
2: 1
3: 12
4: 211
Right 1006494558 6:34412763-34412785 CACTGGCTCATGATCACCTGTGG 0: 1
1: 0
2: 2
3: 16
4: 156
1006494550_1006494558 12 Left 1006494550 6:34412728-34412750 CCCGTCCACTGTGTGCCTCCCAC 0: 1
1: 0
2: 1
3: 23
4: 303
Right 1006494558 6:34412763-34412785 CACTGGCTCATGATCACCTGTGG 0: 1
1: 0
2: 2
3: 16
4: 156
1006494554_1006494558 -6 Left 1006494554 6:34412746-34412768 CCCACCTTCGTATTGTTCACTGG 0: 1
1: 0
2: 1
3: 4
4: 63
Right 1006494558 6:34412763-34412785 CACTGGCTCATGATCACCTGTGG 0: 1
1: 0
2: 2
3: 16
4: 156
1006494557_1006494558 -10 Left 1006494557 6:34412750-34412772 CCTTCGTATTGTTCACTGGCTCA 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1006494558 6:34412763-34412785 CACTGGCTCATGATCACCTGTGG 0: 1
1: 0
2: 2
3: 16
4: 156
1006494553_1006494558 -3 Left 1006494553 6:34412743-34412765 CCTCCCACCTTCGTATTGTTCAC 0: 1
1: 0
2: 0
3: 6
4: 99
Right 1006494558 6:34412763-34412785 CACTGGCTCATGATCACCTGTGG 0: 1
1: 0
2: 2
3: 16
4: 156
1006494548_1006494558 18 Left 1006494548 6:34412722-34412744 CCTTTCCCCGTCCACTGTGTGCC 0: 1
1: 0
2: 0
3: 14
4: 237
Right 1006494558 6:34412763-34412785 CACTGGCTCATGATCACCTGTGG 0: 1
1: 0
2: 2
3: 16
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006494558 Original CRISPR CACTGGCTCATGATCACCTG TGG Intronic
900440556 1:2652967-2652989 CGCTGTCACATGCTCACCTGGGG - Intronic
900454613 1:2768045-2768067 GGCTGGCAAATGATCACCTGGGG - Intronic
900456131 1:2775670-2775692 GGCTGGCAAATGATCACCTGGGG - Intronic
902057775 1:13616676-13616698 CCCTGGCTCCTCATCATCTGAGG - Exonic
903692299 1:25183224-25183246 TACTGGCTCAGGGTCACGTGAGG - Intergenic
905255365 1:36678266-36678288 CACTGACTCTTCATCACCTCTGG - Intergenic
905910428 1:41649693-41649715 CAGTGGCTCAGGATCAAATGCGG + Intronic
906459841 1:46028795-46028817 CCCTGGCGCAGGATCACCTCAGG - Exonic
906701309 1:47860101-47860123 CACTGGCCCTTGATGTCCTGAGG + Intronic
906820586 1:48925996-48926018 CACTGGATAATGATCTCCTGTGG + Intronic
915235047 1:154474278-154474300 CACTGCCTTAGGATCACCTATGG - Intronic
915340852 1:155175929-155175951 CACGGGAACATGATCACTTGGGG - Exonic
915906301 1:159880191-159880213 CGCTGACTCATGATTACCGGGGG + Intronic
916817482 1:168367776-168367798 CAGTGGCTCCCCATCACCTGTGG - Intergenic
918223148 1:182454629-182454651 CACTGTCTCATAATCTACTGGGG - Intronic
919051582 1:192517901-192517923 CAGTGGCTCATCGTTACCTGTGG - Intergenic
919850170 1:201667182-201667204 AACTTGCTAAGGATCACCTGGGG + Intronic
919877529 1:201881126-201881148 AACTGGCTAATGGTAACCTGGGG + Exonic
920085294 1:203411179-203411201 AACTGGCTCCTGATGATCTGAGG - Intergenic
922603911 1:226877187-226877209 CACTGGCTGAGAATCACCCGGGG + Intronic
923848717 1:237768340-237768362 CACTGGCTCTTCATAATCTGTGG - Intronic
1064120655 10:12615224-12615246 CAATGGCTCCCAATCACCTGAGG - Intronic
1065129512 10:22606468-22606490 CATTGTCTCATGATGGCCTGGGG - Intronic
1072123819 10:92428165-92428187 TGGTGGCTCATGATTACCTGAGG + Intergenic
1075332004 10:121580693-121580715 CTCTGGCTCAGGATCCCCTGAGG - Intronic
1077539312 11:3139170-3139192 CACTGCCTCATGGTCACCCCAGG - Intronic
1079141508 11:17813342-17813364 GACTTGCTCATGATCATGTGGGG + Intronic
1086070017 11:82789891-82789913 GACTGGGTCTTGATCACCTCTGG + Intergenic
1086270953 11:85066262-85066284 TACTGGCTCTTGATCTCCTTAGG - Intronic
1086337441 11:85812971-85812993 CACTGGGTCTTGCTCACCTCTGG + Intergenic
1089164889 11:116468235-116468257 CACTGCCTCCTGATCATCTTGGG + Intergenic
1091415196 12:276769-276791 CACTGCCTCAAGAAAACCTGAGG + Intergenic
1092157738 12:6295312-6295334 TACTGACTCATGGTCATCTGTGG - Intergenic
1095654006 12:44648254-44648276 GACTGACTCATGATCATTTGAGG - Intronic
1102140819 12:110613671-110613693 AACTGACTCAGGATCTCCTGAGG + Intergenic
1102280464 12:111614837-111614859 AACTGGCTGTTGGTCACCTGTGG + Intergenic
1103025609 12:117571455-117571477 CACTGGCTCTGAACCACCTGGGG + Intronic
1104372197 12:128233833-128233855 CCTTGGCTCATGGTCACATGTGG + Intergenic
1105013255 12:132769999-132770021 CTGAGGCTCAGGATCACCTGAGG + Exonic
1105847159 13:24303085-24303107 CACTTGCTCATCATCAGCAGGGG - Exonic
1106749148 13:32740612-32740634 TACTTGCACATGATCACCTCAGG + Intronic
1107069427 13:36254813-36254835 CACTGGCTGATGTTCTGCTGAGG + Intronic
1108002681 13:45919104-45919126 CAGTGGCTCATGCTCAACTACGG - Intergenic
1110166599 13:72449876-72449898 CCCCAGCTCATGAGCACCTGTGG + Intergenic
1113454442 13:110438244-110438266 CACTGGCTAATCATCTTCTGAGG + Intronic
1113568919 13:111339506-111339528 CGCTGGCTCATGACCCCCGGGGG - Intronic
1114077195 14:19167510-19167532 CATGGCCTGATGATCACCTGGGG - Intergenic
1118685424 14:68285851-68285873 CAGTGGCTCTTGATAACATGTGG - Intronic
1118785111 14:69039064-69039086 CACTGCCTCATTCTCATCTGGGG - Intergenic
1118825498 14:69376658-69376680 CACTGACTCATGGTCAACTTGGG + Intergenic
1119109645 14:71959615-71959637 CTCTGTGTCAGGATCACCTGAGG + Intronic
1119798484 14:77421146-77421168 CATTTTCTCCTGATCACCTGAGG + Intronic
1120188586 14:81419698-81419720 CACTGGCCCATGATCCTCTAGGG + Intronic
1120244829 14:81994576-81994598 CCCAGTCTCAGGATCACCTGGGG - Intergenic
1120538092 14:85721870-85721892 AACTGCCTGATCATCACCTGAGG - Intergenic
1121126285 14:91408859-91408881 CACAGCCTCATGGTCACCTAGGG - Intronic
1125986117 15:44054248-44054270 CAATGCCTCATTTTCACCTGTGG - Intronic
1128412189 15:67410809-67410831 CACTGACTTAGCATCACCTGTGG + Intronic
1129237032 15:74229880-74229902 CCCTGGCTCATGATCCACTGTGG - Intergenic
1132281119 15:100616802-100616824 CACTTGCTTATGGCCACCTGTGG + Intronic
1132735911 16:1385801-1385823 GACTGGCTCCTGAGCACCTTGGG + Intronic
1133181837 16:4060741-4060763 CTCTGGATTATGATCACCTTTGG - Intronic
1134194870 16:12151965-12151987 CTCGGCCTCAGGATCACCTGAGG - Intronic
1135793784 16:25422576-25422598 CACTGGCTGAAGATCACCTGAGG + Intergenic
1135884359 16:26292082-26292104 GACTGGCTCCTGATGACCTCTGG - Intergenic
1138799893 16:60014450-60014472 CATTGTCTCATGAACACATGAGG + Intergenic
1139587724 16:67915018-67915040 AACTGGCTATTGATTACCTGAGG + Intronic
1139603684 16:68002534-68002556 CAGGGCCTCATCATCACCTGCGG + Intronic
1141130529 16:81433363-81433385 CACTGGCCTGTGACCACCTGGGG - Intergenic
1142638939 17:1274095-1274117 CACAGGCCCAGGATCCCCTGCGG - Intergenic
1143623217 17:8093037-8093059 GACTTGCTCAAGATCAGCTGGGG + Intergenic
1144707314 17:17378123-17378145 CACTGGCTCATGTGCACCCAGGG + Intergenic
1148658896 17:49311250-49311272 CACTTGTTGATGATCATCTGTGG - Intronic
1150128369 17:62653070-62653092 CACTGGCTCTTCCTCACCGGGGG - Intronic
1151181671 17:72333614-72333636 AACAGGCTCATGGACACCTGTGG + Intergenic
1153675072 18:7449934-7449956 CAATGGCTCAGGATAACTTGGGG + Intergenic
1153925787 18:9833472-9833494 CACTGGCTGATGTTCTGCTGAGG - Intronic
1156601754 18:38615564-38615586 TACTGGCTCAGTATCAGCTGTGG - Intergenic
1160461337 18:79041311-79041333 CACTGCCTCATGGTCACATTCGG - Intergenic
1161516522 19:4699664-4699686 CACAGGGTCCTCATCACCTGGGG - Intronic
1162451223 19:10756374-10756396 CACTGGCTCCTGAGCACTTGGGG - Intronic
1162587009 19:11566161-11566183 CACTGGCTCAGGGTCAGGTGTGG - Intronic
1163048566 19:14663604-14663626 CCCTGCCTCTTGATCACCTGAGG + Intronic
1163762970 19:19147019-19147041 CACTGTCCCATGCTCACCTGGGG + Exonic
1166748157 19:45151798-45151820 CTCTGGCTCAGGTTCACCTGGGG + Exonic
925720815 2:6825062-6825084 GACTGGCTCTGCATCACCTGAGG + Intergenic
925793703 2:7520265-7520287 CACTGGCTCATCATTTACTGTGG + Intergenic
926925031 2:17978657-17978679 CAATGGCTTTTGATCACCTGTGG + Intronic
928328529 2:30339113-30339135 GACTTGCTGATGATCACATGTGG + Intergenic
931411048 2:62032243-62032265 CACTGACTCATGACCAGGTGTGG + Intronic
931999998 2:67876431-67876453 GACTGTCTCACGATCACCTCTGG + Intergenic
934044663 2:88162832-88162854 CACTGGATCAGAATCACCTGGGG + Intergenic
934560052 2:95308504-95308526 CACTGGCTCATGGTCCCCTGAGG - Intronic
937745385 2:125406138-125406160 CACTTACTCATGGTCAACTGTGG - Intergenic
939057074 2:137378842-137378864 CTCTGGCTGATGATCTGCTGTGG - Intronic
941102437 2:161311071-161311093 CTGAGGCTCAGGATCACCTGAGG + Intronic
945351007 2:208779931-208779953 AACTGGCTCAAAATCACATGTGG - Intronic
946355391 2:219181390-219181412 CAGTGGCTCATCACCTCCTGGGG - Exonic
948022729 2:234749590-234749612 CACAGGCTCAGCATCCCCTGAGG + Intergenic
948942605 2:241203781-241203803 CACTGGCCCATGAGGCCCTGGGG + Intronic
1173374891 20:42474468-42474490 CCCTGGCCCCTGATCAACTGAGG + Intronic
1174193431 20:48756341-48756363 CACTGGCTCAGAACCAACTGAGG + Intronic
1174567193 20:51473829-51473851 CACTGGCCCAAGATGACCAGAGG - Intronic
1174669043 20:52288761-52288783 CACTGCCTGATGAACACCTCAGG - Intergenic
1177867594 21:26531215-26531237 CAGTGGCTCATGCTCACCACAGG + Intronic
1178931441 21:36822036-36822058 CAATGGCTCATTAGCAGCTGTGG - Intronic
1179996111 21:44975217-44975239 CCCTGGGTCATGCTCCCCTGGGG + Intronic
1180080224 21:45483269-45483291 CGCAGGCTCATGAGCATCTGGGG + Intronic
1181134130 22:20752277-20752299 GGCTGGCTCCTGACCACCTGTGG + Intronic
1183413047 22:37666488-37666510 CACTGGGTCACTATCACTTGGGG - Exonic
950264337 3:11563182-11563204 CTCTGGCCCTTGATGACCTGGGG - Intronic
951646608 3:24898954-24898976 AACTGTCTCATGACCACCTCTGG + Intergenic
952713729 3:36457163-36457185 CATTTGCTGATGATCACCTGTGG - Intronic
954938794 3:54352073-54352095 CCCTGGCCTATCATCACCTGGGG - Intronic
956081615 3:65563365-65563387 CACTGGAGCTTGAACACCTGGGG - Intronic
956293961 3:67691991-67692013 CTGTGCCTCATAATCACCTGGGG + Intergenic
958723700 3:97877521-97877543 CACTGTCTCTTGATTTCCTGGGG - Exonic
962559157 3:136588148-136588170 CACTTGCTCATTATCTACTGGGG + Intronic
962801489 3:138894667-138894689 CACTGCTTCATTATCATCTGGGG + Intergenic
963083216 3:141413664-141413686 CACCTGCTCATGATGACTTGTGG + Intronic
963396667 3:144743150-144743172 CACTGGCTCATAATCCCCATTGG - Intergenic
964974443 3:162601998-162602020 CACTGGTTCTTTCTCACCTGTGG - Intergenic
967506840 3:190262040-190262062 CACTGGCTGATGATACCCTGGGG - Intergenic
969286622 4:6206441-6206463 CACTGGCCCATGAGCCCTTGGGG - Intergenic
971241309 4:24891436-24891458 CACTGGCTGCAGATCACCAGTGG + Intronic
972091878 4:35296898-35296920 CACTGGCTCCTGATGACACGAGG + Intergenic
973831968 4:54770645-54770667 CAGTGACTCATGGTCAACTGTGG + Intergenic
973923607 4:55714537-55714559 CACTGGCTCAGGATAATCTAGGG - Intergenic
982343393 4:154329667-154329689 CACTGGATCGTGAGCACCGGGGG - Exonic
982475156 4:155841445-155841467 CACTTGTTCAAGATCACCTAGGG + Intronic
984526673 4:180866445-180866467 CTCTGGCTCATGAAATCCTGCGG + Intergenic
986680871 5:10231722-10231744 CACTAGCATATGAGCACCTGGGG + Intronic
988935037 5:36073511-36073533 CACTGGTTCCTTATCATCTGAGG + Intergenic
991069873 5:62464704-62464726 CAGAGGCAGATGATCACCTGGGG - Intronic
991974215 5:72170579-72170601 CAGTGGCTCAGTATCCCCTGTGG + Intronic
995716695 5:115087630-115087652 CACTGCTTCCTGATCATCTGGGG + Intergenic
997169185 5:131698152-131698174 CACTTGCCCAAGATCACCAGAGG + Intronic
998069198 5:139183501-139183523 CACTGGCTGATTCTCACCTCTGG - Intronic
998158982 5:139802481-139802503 CACAGGCTCATGTTAGCCTGTGG + Intronic
998535834 5:142929983-142930005 CTCTGCATCAAGATCACCTGGGG + Intronic
1000175733 5:158751341-158751363 CCCTGGCTCATAATGACCTGAGG + Intronic
1001691995 5:173640030-173640052 CCATGGCTCATGGTTACCTGAGG - Intergenic
1002119522 5:176991484-176991506 GACTGCCTCTCGATCACCTGAGG + Intronic
1003893002 6:10580230-10580252 CCTGGGCTCATGATCCCCTGTGG + Intronic
1006494558 6:34412763-34412785 CACTGGCTCATGATCACCTGTGG + Intronic
1018105836 6:160485318-160485340 CACTGGGTCCTGAGCACCAGTGG - Intergenic
1019173675 6:170148940-170148962 CACTGCCTCAAGACCACGTGGGG - Intergenic
1020785924 7:12571881-12571903 CACTGGCACAAGACCTCCTGGGG - Intronic
1024518792 7:50284612-50284634 GACTGGCTCATGCTTTCCTGTGG - Intergenic
1024985755 7:55192103-55192125 CATTTGCTAATGATCACCTGGGG - Intronic
1029166529 7:98595359-98595381 CACTGGCGCAGCCTCACCTGGGG + Intergenic
1029282511 7:99445205-99445227 CACTGGCTCATGGTTTTCTGTGG + Intronic
1029594104 7:101527780-101527802 CACTGGCCCTGGAGCACCTGGGG - Intronic
1030681300 7:112437190-112437212 CACTGGCTCCTGATTGCCTGCGG - Intronic
1031609957 7:123814220-123814242 GGCTGGCTCTTGATCACCGGAGG - Intergenic
1033500695 7:141946267-141946289 AACTGGCACATGATCATCTCTGG - Exonic
1036122442 8:6033121-6033143 CACATGCACATGATCTCCTGGGG - Intergenic
1037509488 8:19567201-19567223 TACTGGCTCATGATCAGCTCAGG - Intronic
1038336822 8:26652302-26652324 CCCTGGCTGATGACCACCAGTGG - Exonic
1041738678 8:61136942-61136964 CACTGGCTCCTGATGAAGTGTGG + Intronic
1042928635 8:73992217-73992239 CACTTGCTAATGAGCAGCTGGGG - Intronic
1049731709 8:144181563-144181585 CACAGGCTCTTTCTCACCTGTGG + Intronic
1055154453 9:73043092-73043114 CACTTGCTCTTGCTCACTTGAGG + Intronic
1055606961 9:77980254-77980276 CACTGGTTTATGAGCACCAGGGG - Intronic
1056984028 9:91344450-91344472 CACATTCTCATGATCTCCTGGGG + Intronic
1059730320 9:117050684-117050706 CACAGGGTCAGGATCAGCTGAGG - Intronic
1061038368 9:128125866-128125888 CCCAGGCTCATGTTCACCAGTGG + Intronic
1062343049 9:136102259-136102281 CACTGGCCCCTGCTCATCTGGGG + Intergenic
1185922987 X:4114602-4114624 GACTGGCTCTTCATCACCTGAGG + Intergenic
1187754748 X:22510477-22510499 CACTGTCTAATGATCACATCAGG + Intergenic
1193332622 X:80252411-80252433 TACTGACTCAGGCTCACCTGGGG + Intergenic
1193739087 X:85196062-85196084 CACAGGCTCAGTATAACCTGAGG - Intergenic
1197252571 X:124230731-124230753 CATTGGCTCATTATCAGGTGAGG + Intronic
1199690680 X:150306827-150306849 CACTGGCTCATGGTAAGCCGTGG + Intergenic
1200841998 Y:7791800-7791822 AACTGCATCAGGATCACCTGGGG + Intergenic