ID: 1006494559

View in Genome Browser
Species Human (GRCh38)
Location 6:34412764-34412786
Sequence ACTGGCTCATGATCACCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006494546_1006494559 21 Left 1006494546 6:34412720-34412742 CCCCTTTCCCCGTCCACTGTGTG 0: 1
1: 0
2: 0
3: 22
4: 234
Right 1006494559 6:34412764-34412786 ACTGGCTCATGATCACCTGTGGG No data
1006494556_1006494559 -6 Left 1006494556 6:34412747-34412769 CCACCTTCGTATTGTTCACTGGC 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1006494559 6:34412764-34412786 ACTGGCTCATGATCACCTGTGGG No data
1006494551_1006494559 12 Left 1006494551 6:34412729-34412751 CCGTCCACTGTGTGCCTCCCACC 0: 1
1: 0
2: 14
3: 195
4: 1653
Right 1006494559 6:34412764-34412786 ACTGGCTCATGATCACCTGTGGG No data
1006494552_1006494559 8 Left 1006494552 6:34412733-34412755 CCACTGTGTGCCTCCCACCTTCG 0: 1
1: 0
2: 0
3: 27
4: 271
Right 1006494559 6:34412764-34412786 ACTGGCTCATGATCACCTGTGGG No data
1006494550_1006494559 13 Left 1006494550 6:34412728-34412750 CCCGTCCACTGTGTGCCTCCCAC 0: 1
1: 0
2: 1
3: 23
4: 303
Right 1006494559 6:34412764-34412786 ACTGGCTCATGATCACCTGTGGG No data
1006494547_1006494559 20 Left 1006494547 6:34412721-34412743 CCCTTTCCCCGTCCACTGTGTGC 0: 1
1: 0
2: 0
3: 33
4: 193
Right 1006494559 6:34412764-34412786 ACTGGCTCATGATCACCTGTGGG No data
1006494553_1006494559 -2 Left 1006494553 6:34412743-34412765 CCTCCCACCTTCGTATTGTTCAC 0: 1
1: 0
2: 0
3: 6
4: 99
Right 1006494559 6:34412764-34412786 ACTGGCTCATGATCACCTGTGGG No data
1006494557_1006494559 -9 Left 1006494557 6:34412750-34412772 CCTTCGTATTGTTCACTGGCTCA 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1006494559 6:34412764-34412786 ACTGGCTCATGATCACCTGTGGG No data
1006494549_1006494559 14 Left 1006494549 6:34412727-34412749 CCCCGTCCACTGTGTGCCTCCCA 0: 1
1: 0
2: 1
3: 12
4: 211
Right 1006494559 6:34412764-34412786 ACTGGCTCATGATCACCTGTGGG No data
1006494548_1006494559 19 Left 1006494548 6:34412722-34412744 CCTTTCCCCGTCCACTGTGTGCC 0: 1
1: 0
2: 0
3: 14
4: 237
Right 1006494559 6:34412764-34412786 ACTGGCTCATGATCACCTGTGGG No data
1006494554_1006494559 -5 Left 1006494554 6:34412746-34412768 CCCACCTTCGTATTGTTCACTGG 0: 1
1: 0
2: 1
3: 4
4: 63
Right 1006494559 6:34412764-34412786 ACTGGCTCATGATCACCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006494559 Original CRISPR ACTGGCTCATGATCACCTGT GGG Intronic
No off target data available for this crispr