ID: 1006502100

View in Genome Browser
Species Human (GRCh38)
Location 6:34465793-34465815
Sequence AGGGCGCACCGGAGGGCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006502083_1006502100 16 Left 1006502083 6:34465754-34465776 CCCGGGCTCCGAGCGCGCCAGCT No data
Right 1006502100 6:34465793-34465815 AGGGCGCACCGGAGGGCTCCCGG No data
1006502094_1006502100 -1 Left 1006502094 6:34465771-34465793 CCAGCTGGGAGGGCTGGGGAGGA No data
Right 1006502100 6:34465793-34465815 AGGGCGCACCGGAGGGCTCCCGG No data
1006502089_1006502100 8 Left 1006502089 6:34465762-34465784 CCGAGCGCGCCAGCTGGGAGGGC No data
Right 1006502100 6:34465793-34465815 AGGGCGCACCGGAGGGCTCCCGG No data
1006502084_1006502100 15 Left 1006502084 6:34465755-34465777 CCGGGCTCCGAGCGCGCCAGCTG No data
Right 1006502100 6:34465793-34465815 AGGGCGCACCGGAGGGCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006502100 Original CRISPR AGGGCGCACCGGAGGGCTCC CGG Intergenic
No off target data available for this crispr