ID: 1006502295

View in Genome Browser
Species Human (GRCh38)
Location 6:34466482-34466504
Sequence TGCCACTGCGCTGGGTCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 290}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006502290_1006502295 -6 Left 1006502290 6:34466465-34466487 CCCAGGCAGTGCCAGGATGCCAC 0: 1
1: 0
2: 1
3: 23
4: 205
Right 1006502295 6:34466482-34466504 TGCCACTGCGCTGGGTCCCTTGG 0: 1
1: 0
2: 0
3: 20
4: 290
1006502285_1006502295 23 Left 1006502285 6:34466436-34466458 CCTTCAGGGGACGGAGTTCGCGG 0: 1
1: 0
2: 0
3: 3
4: 29
Right 1006502295 6:34466482-34466504 TGCCACTGCGCTGGGTCCCTTGG 0: 1
1: 0
2: 0
3: 20
4: 290
1006502291_1006502295 -7 Left 1006502291 6:34466466-34466488 CCAGGCAGTGCCAGGATGCCACT 0: 1
1: 0
2: 0
3: 24
4: 225
Right 1006502295 6:34466482-34466504 TGCCACTGCGCTGGGTCCCTTGG 0: 1
1: 0
2: 0
3: 20
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006502295 Original CRISPR TGCCACTGCGCTGGGTCCCT TGG Intronic
901447110 1:9315285-9315307 TGGCACGGGGCTGTGTCCCTTGG - Intronic
901461790 1:9396371-9396393 AGCCACTGCGCCCGGTCCCCAGG - Intergenic
901646723 1:10720838-10720860 TGCCTCTCCCCTTGGTCCCTTGG - Intronic
904277666 1:29394869-29394891 TGCCTTTTCGCTGGGGCCCTGGG - Intergenic
910163594 1:84299199-84299221 TGGGACCGCGCTGGCTCCCTAGG + Intronic
910975511 1:92901908-92901930 AGCCACTGCTCTGTTTCCCTAGG + Intronic
911115757 1:94245871-94245893 AGCCACTGCTCTTGGTCCCGGGG - Intronic
912447598 1:109749782-109749804 TGCAGCTGTGCTGGGTGCCTTGG + Intronic
912712202 1:111958086-111958108 GGTCACTGGGCAGGGTCCCTAGG - Intronic
915601026 1:156923565-156923587 TGGAACTGCTCAGGGTCCCTGGG - Intronic
915674972 1:157521038-157521060 TCTCACTGCGCTGGGCCCCGAGG + Exonic
915675660 1:157527638-157527660 TGTCACTGTGCTGGGCCACTAGG + Exonic
916490875 1:165301218-165301240 TTCCACTGCTCTGGTTCCATTGG + Intronic
918073336 1:181150105-181150127 TGACCCTGCCCTGGTTCCCTGGG + Intergenic
922167844 1:223130500-223130522 TGCCAGTTCTCTGGGTTCCTTGG + Intronic
924430931 1:243995808-243995830 TGCCACTTCACTGTGACCCTCGG + Intergenic
924656967 1:245981310-245981332 TGCCACTGCTGGGTGTCCCTTGG + Intronic
1062982555 10:1737339-1737361 TCCCACTGGGCTGGGGGCCTCGG + Exonic
1063204190 10:3814962-3814984 AGCCACTGCGCCCGGCCCCTAGG + Intergenic
1064099542 10:12451469-12451491 AGCCAGGGCACTGGGTCCCTGGG - Intronic
1065796725 10:29314839-29314861 TGCCATTGCGCTGTGGCCCCTGG - Intronic
1066006156 10:31147822-31147844 AGCCACTGTGCCTGGTCCCTGGG - Intergenic
1066421440 10:35268178-35268200 AGCCACTGTGCAGGGCCCCTTGG + Intronic
1067102661 10:43344127-43344149 GGCCACTGCGCTGTCTCCCGGGG - Intergenic
1069757910 10:70785135-70785157 TGCCCCTGCTCTCTGTCCCTGGG + Intronic
1069885836 10:71623041-71623063 TGCCACTGTGCTAGGTCCTGGGG + Intronic
1070064292 10:73018351-73018373 AGCCACTGCTCTGTTTCCCTGGG - Intronic
1070241674 10:74688387-74688409 AGGCACTGTGCTGGGTCCCGGGG - Intronic
1070648114 10:78215572-78215594 TGCCAGCTCTCTGGGTCCCTGGG + Intergenic
1070724377 10:78778288-78778310 TGGCACTGCCCTGGGCCCCCTGG - Intergenic
1073609910 10:104933014-104933036 AGCCACTGTGCTGGCCCCCTTGG + Intronic
1074288009 10:112116483-112116505 AGCCACTGCGCTGGGTCCTGAGG + Intergenic
1075549190 10:123379573-123379595 TGCCCCTGGGCTGCCTCCCTGGG - Intergenic
1075754189 10:124798064-124798086 TGCCACTGGGCTGGGTGCAGTGG - Intergenic
1076351056 10:129815666-129815688 GCCCTCTGCTCTGGGTCCCTTGG - Intergenic
1076855433 10:133113545-133113567 CCCCACTGGGCTGGGGCCCTCGG + Intronic
1077239014 11:1500951-1500973 TGCCAATGTGCTGGGTGCCCAGG - Intronic
1081131610 11:39388119-39388141 TGCTACTGCACTGGGTGCCTGGG - Intergenic
1081664109 11:44906546-44906568 TCACACTGGGCTGAGTCCCTGGG + Intronic
1081689814 11:45070279-45070301 AGCCACTGCGCCTGGGCCCTGGG - Intergenic
1083017830 11:59474769-59474791 AGCCTCTGCGCCCGGTCCCTTGG - Intergenic
1083197958 11:61102297-61102319 TGCCCCAGCCCTGGGTACCTTGG + Intergenic
1084011737 11:66354190-66354212 TGCCACTGCACTGGAGACCTTGG + Intronic
1084291695 11:68174568-68174590 TGCCACTGCGCTCCAGCCCTGGG - Intronic
1087725112 11:101707716-101707738 TGGCACAGCACTGGGACCCTGGG - Intronic
1090560636 11:127928258-127928280 TGCCACTGAGATGGCTTCCTGGG - Intergenic
1091643141 12:2252836-2252858 TGGCACTTTGCTGGGTCCATGGG + Intronic
1092121273 12:6045695-6045717 TGGCACAGAACTGGGTCCCTTGG + Intronic
1092680186 12:10970085-10970107 AGCCACTGCACCTGGTCCCTTGG + Intronic
1093771554 12:23023549-23023571 TGCCAAGGAGCTGGGTCCTTAGG + Intergenic
1094836509 12:34324630-34324652 AGCCACTGCGCAGGGCCCCGGGG - Intergenic
1094836973 12:34326634-34326656 ATCCCCTGCGCGGGGTCCCTGGG - Intergenic
1094837147 12:34327454-34327476 AGCCCCTGCGCTGGGCCCCACGG - Intergenic
1094837861 12:34330587-34330609 AGCCCCTGCGCTGGGACCCAGGG - Intergenic
1096628249 12:52908125-52908147 TGCCACTGCTCAGGGTCTCAGGG - Intronic
1096848169 12:54419139-54419161 TGCAGCTGCGCTGGGGCCCCCGG - Exonic
1097895302 12:64819456-64819478 TGCCACTGCACTGGCAGCCTGGG - Intronic
1103943818 12:124515155-124515177 TGTAACTGAGCTTGGTCCCTTGG - Intronic
1104763252 12:131310948-131310970 CGGCACTGCGCTGGGCCCCTGGG - Intergenic
1104816246 12:131647122-131647144 CGGCACTGCGCTGGGCCCCTGGG + Intergenic
1105068087 12:133217309-133217331 TGCCTCTTTGCTGGGTCTCTGGG + Intergenic
1106127362 13:26911367-26911389 TGGCTCTGTGCTGGGACCCTGGG - Intergenic
1106810420 13:33353215-33353237 TGCCTCTACCCTGTGTCCCTGGG + Intergenic
1107719711 13:43235445-43235467 AGCCACCGCGCCTGGTCCCTGGG - Intronic
1108134953 13:47346105-47346127 AGCCACTGCGCCGGGCCTCTGGG - Intergenic
1108482104 13:50883985-50884007 TGCCACTGCTCAGATTCCCTAGG + Intergenic
1112037664 13:95512604-95512626 TGATACTGCTCTGGGCCCCTGGG - Intronic
1112115846 13:96352493-96352515 TTCCACTGCGCCGTGTCCCTTGG - Intronic
1113007985 13:105729545-105729567 TGCAACTGAGATGTGTCCCTGGG - Intergenic
1113355650 13:109577480-109577502 TGCCCCTCCACTGGGTTCCTGGG - Intergenic
1113398080 13:109967430-109967452 AGCCACTGCGCCTGGCCCCTAGG - Intergenic
1113785253 13:112999076-112999098 TGGCCCTGCTCTGTGTCCCTGGG - Intronic
1113838183 13:113343332-113343354 TGCTGCTGCACTGGGTCCCTGGG + Intronic
1114075018 14:19157263-19157285 AGCCCCTGCGCTGGGCCCCGTGG + Intergenic
1114075487 14:19159177-19159199 AGCCCCTGCGCTGGGCCCCGGGG + Intergenic
1114086781 14:19240802-19240824 AGCCCCTGCGCTGGGCCCCGGGG - Intergenic
1114086893 14:19241224-19241246 AGCCCCTGCGCTAGGTCCCGTGG - Intergenic
1114087250 14:19242713-19242735 AGCCCCTGCGCTGGGCCCCGTGG - Intergenic
1114673632 14:24427879-24427901 TGCTACTGCCCTTGGACCCTGGG - Exonic
1118568847 14:67172597-67172619 AGCCACTGCTCTGTTTCCCTGGG - Intronic
1118975834 14:70675902-70675924 AGCCATTGTGCTGGGTCTCTGGG + Intergenic
1119380726 14:74226423-74226445 TGGCACTGGGATGGGTCCATGGG - Intergenic
1119466601 14:74863347-74863369 GGCCCCTGAGCTGTGTCCCTGGG + Exonic
1120853503 14:89192889-89192911 TCCCACTGCCCCGGGTCCCTTGG + Intronic
1121429767 14:93878621-93878643 TGGCACAGTGCTGGGTCCCTGGG + Intergenic
1122203403 14:100136168-100136190 AGCCACTGTGATGGGTCCCCAGG + Intronic
1122962109 14:105099165-105099187 TGCCACTGTGCTGGGGGCTTTGG + Intergenic
1123023373 14:105412369-105412391 GGGCACTGCATTGGGTCCCTGGG - Exonic
1202899072 14_GL000194v1_random:25443-25465 AGCCACTGCGCTTGGCCCCGTGG - Intergenic
1123937098 15:25199294-25199316 GGCCACTGGCCTGGGTCCATTGG - Intergenic
1123983055 15:25621336-25621358 TGCCATGGCTCAGGGTCCCTGGG - Intergenic
1125775859 15:42213112-42213134 TGGTACTGTGCTGGGTCCATGGG - Intronic
1125990921 15:44107084-44107106 TACCATTGTGCTGGGGCCCTGGG - Intronic
1127255871 15:57292282-57292304 TTCCACTACGCTGGGTCCCCAGG + Intronic
1128648832 15:69396058-69396080 TGCTTCTGTGCTGGGTCCCCAGG + Intronic
1128796077 15:70467694-70467716 TCCTACTGGACTGGGTCCCTTGG - Intergenic
1128914495 15:71547283-71547305 AGGCACCGCGCTGGTTCCCTCGG - Intronic
1129461769 15:75703335-75703357 TGCCCCTGCGCAGGGTCACCCGG - Intronic
1129723083 15:77888511-77888533 TGCCCCTGCGCAGGGTCACCCGG + Intergenic
1131144297 15:90001577-90001599 GGCTCCTGCGCTGGGGCCCTCGG - Exonic
1132376977 15:101334850-101334872 TGCCTGTCTGCTGGGTCCCTGGG - Intronic
1134059301 16:11189271-11189293 TGCCATTGCCATTGGTCCCTCGG - Intergenic
1135596733 16:23750189-23750211 AGCCACTGCGCCTGGTCCCAGGG - Intergenic
1135937352 16:26792641-26792663 TCCCATTGCTCTGGGTCTCTGGG + Intergenic
1138197081 16:55059675-55059697 GGCCACTGGGCTGGGCCTCTGGG + Intergenic
1138489119 16:57365994-57366016 TGACACTGAGCTGGATGCCTAGG - Exonic
1139738836 16:69017307-69017329 TGCCACTGTGCTGGGCCCTGGGG - Intronic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1142385790 16:89763651-89763673 AGCCACTGCGCTCGGCCCCTGGG - Intronic
1143025557 17:3939743-3939765 TGCCACTGCGCTCCAGCCCTGGG + Intronic
1143376534 17:6470675-6470697 TGCCACTGAGCGGCGGCCCTGGG - Intronic
1143651114 17:8264805-8264827 TCCCACTGCCCTGAGTGCCTTGG + Intronic
1143714286 17:8755972-8755994 TGCCTCTGCACAGGGTCCTTTGG - Intronic
1147481869 17:40772724-40772746 AGCCACTGCCCTGGGTGTCTGGG + Intergenic
1147868993 17:43574123-43574145 TGCAGCTTCGCTGGGCCCCTGGG + Intronic
1147879186 17:43643021-43643043 AGCCACTGCGCCCGGCCCCTGGG - Intronic
1148072956 17:44919255-44919277 TGCCACTGCACTCTGGCCCTGGG - Intergenic
1149444270 17:56701401-56701423 TGACTTTGCGCTGAGTCCCTAGG - Intergenic
1149679396 17:58494817-58494839 TGCCACTGAGTTAGGTGCCTGGG - Intronic
1150134666 17:62689279-62689301 GGCCTCTGCGCCGGGTTCCTTGG + Intronic
1151252115 17:72844381-72844403 AGCCACTGCGCCTGGTCCCTTGG - Intronic
1154160355 18:11976832-11976854 TGCCACTGCCCTGGCTTCTTGGG + Intergenic
1155305663 18:24475581-24475603 TGCCACTGCACTGCAGCCCTGGG + Intronic
1155550021 18:26954876-26954898 TATCACTGAGCTGGGTCCTTAGG - Intronic
1157521329 18:48347559-48347581 TGCCTCTGCCTTGGGCCCCTGGG + Intronic
1158267579 18:55677258-55677280 TTACCCTGCTCTGGGTCCCTGGG + Intergenic
1158412727 18:57222085-57222107 TGCCCCTGCTCTGTGTCCCCAGG + Intergenic
1160438614 18:78870881-78870903 TACATCTGAGCTGGGTCCCTCGG - Intergenic
1160824766 19:1074477-1074499 AGCCCCTGCTCTTGGTCCCTGGG - Intronic
1160912458 19:1481277-1481299 TCCCACTGCCTGGGGTCCCTGGG + Intergenic
1161294522 19:3513019-3513041 AGGGACTGCGCTGGGTGCCTGGG - Intronic
1161954417 19:7485209-7485231 TGCCACTGCACTGGCAGCCTGGG - Intronic
1162906136 19:13825310-13825332 AGCCACTGCGCCCGGCCCCTAGG + Intronic
1163501354 19:17678435-17678457 TGCCACTGCACTGCAGCCCTTGG + Intronic
1163676151 19:18656281-18656303 TGCCACCTCACTGGGTCCTTGGG + Intronic
1163861583 19:19745856-19745878 AGCCACTGAGCTGGCTCCATGGG + Intergenic
1165719257 19:38067399-38067421 GGGGACTGCCCTGGGTCCCTGGG + Intronic
1166220543 19:41361500-41361522 AGCCACTGCGCCTGGCCCCTGGG - Intronic
1167348402 19:48960989-48961011 CGCCACTCCTCTGGGACCCTGGG + Exonic
1167395105 19:49223318-49223340 TGCCTCTTGGTTGGGTCCCTGGG - Intergenic
1167405136 19:49301769-49301791 GGCCACTGGGGTGAGTCCCTGGG - Intronic
1167554777 19:50187838-50187860 TGCACGTGCGGTGGGTCCCTTGG - Intergenic
926375757 2:12225699-12225721 CTCCACTGCACTGGGTCCTTCGG + Intergenic
926821452 2:16855368-16855390 GGCCAGGCCGCTGGGTCCCTGGG + Intergenic
927695189 2:25235109-25235131 TGTCACTGCAGTGGTTCCCTGGG + Intronic
931100980 2:59000796-59000818 TGGCACTGCACTGGGTTCCAGGG + Intergenic
934088416 2:88529576-88529598 TCCAACTGCACTGGGACCCTGGG + Exonic
934476169 2:94594970-94594992 TGCCTCTGAGCTGGGAGCCTGGG + Intronic
934734953 2:96685485-96685507 GGGCACTGCGCTGAGTCCCCAGG - Intergenic
938033597 2:128016984-128017006 TGCCACTCCACTTGGTCCCATGG + Intronic
938200073 2:129365688-129365710 CAACACTGCGGTGGGTCCCTTGG - Intergenic
938489339 2:131753806-131753828 AGCCCCTGCGCTGGGCCCCGTGG + Intronic
938489974 2:131756276-131756298 AGCCACTGCGCTTGGCCCCGTGG + Intronic
939398575 2:141662425-141662447 TGCCCATGAGCTGGGTCTCTTGG - Intronic
940879562 2:158933187-158933209 TGCCCCTGCACAGGGTCACTGGG + Intergenic
942403670 2:175630172-175630194 TGCCACTGCACTGGGTGAGTAGG - Intergenic
942619821 2:177834639-177834661 TCCCACTGAGCTGGACCCCTTGG - Intronic
945103774 2:206289101-206289123 AGCCACTGCTCTGTTTCCCTGGG + Intronic
948278593 2:236729034-236729056 TGGCACTTCTCTGTGTCCCTGGG + Intergenic
948861247 2:240753603-240753625 CGCCACTGTGCTTGGCCCCTAGG - Intronic
1168818079 20:754537-754559 AGCCACTGCACTGGGCCACTGGG - Intergenic
1168818709 20:759174-759196 AGCCACTGCGCCCGGCCCCTGGG - Intergenic
1169318008 20:4609193-4609215 TGCCCCTGCTCTGGGTGCCTGGG - Intergenic
1169379894 20:5097290-5097312 TGCCACTCTGGTGGGTCTCTTGG - Intronic
1169933365 20:10857604-10857626 TGTGACTGCCCTGGGACCCTGGG + Intergenic
1171154538 20:22860043-22860065 TGCCACTGTACTGGGCCTCTTGG - Intergenic
1173173014 20:40742360-40742382 AGCCCCTGTGCTGGGTCCCAAGG - Intergenic
1173841078 20:46157704-46157726 GGCCACTGAGCAGGGCCCCTGGG - Intergenic
1174767227 20:53265595-53265617 TGCCACCTCCCTGGCTCCCTCGG + Intronic
1175900599 20:62358499-62358521 TGCCACTGGCTTGGCTCCCTGGG - Intronic
1176001030 20:62831276-62831298 TTCCAGTGAGCTGGGGCCCTGGG - Intronic
1176618457 21:9040208-9040230 AGCCACTGCGCTTGGCCCCGTGG - Intergenic
1176706533 21:10122853-10122875 AGCCCCTGCGCTGGGCCCCATGG + Intergenic
1176706719 21:10123649-10123671 AGCCACTGCGCTTGGCCCCATGG + Intergenic
1178901675 21:36604146-36604168 TCCCACTCAGCTGGGTCACTTGG + Intergenic
1180004424 21:45013466-45013488 TGGCACTGCTGTGGGTCCCCTGG + Intergenic
1180032765 21:45223684-45223706 TGCCCCTGCTCTGGTTTCCTAGG - Exonic
1180290668 22:10850178-10850200 AGCCCCTGCGCTGGGCCCCGTGG + Intergenic
1180291080 22:10851932-10851954 AGCCCCTGCGCTGGGCCCCGGGG + Intergenic
1180353868 22:11823721-11823743 AGCCCCTGCGCTGGGCCCCCTGG - Intergenic
1180384379 22:12168604-12168626 AGCCCCTGCGCTGGGCCCCCTGG + Intergenic
1180493469 22:15879599-15879621 AGCCCCTGCGCTGGGCCCCGTGG + Intergenic
1180493885 22:15881354-15881376 AGCCCCTGCGCTGGGCCCCGGGG + Intergenic
1180608730 22:17081859-17081881 AGCCACTGCTCTGGGCCCCCAGG - Intergenic
1180734286 22:18004051-18004073 AGCCACTGCGCCTGGCCCCTGGG + Intronic
1181885701 22:26020735-26020757 TGACACTGCCCTAGGTCCCAGGG - Intronic
1182273589 22:29171091-29171113 AGCCACTGCGCCTGGCCCCTGGG - Intergenic
1183093605 22:35540034-35540056 TGCCAGTCCGCAGGGTCCCGTGG + Intergenic
1185049017 22:48544030-48544052 TGCCAGTGCCATGGGTACCTGGG + Intronic
949709971 3:6861564-6861586 GGGCACTCCGCTGGGACCCTTGG - Exonic
949980253 3:9498331-9498353 TGCCACTTCTCTGAGTCACTGGG - Intergenic
951742872 3:25943778-25943800 AGCCACTGTGCTTGGTCCCTAGG + Intergenic
952388377 3:32859677-32859699 TGCCGCTGGCCTGGGTGCCTGGG + Intronic
954369611 3:50163327-50163349 TTCCACTGAGCAGGGTCCCTAGG + Intronic
954560308 3:51550697-51550719 TGCCACTGCACTCGGGCCCAGGG + Intronic
954882230 3:53844146-53844168 TGACACTGCCCTGGCCCCCTGGG - Intronic
955090836 3:55749131-55749153 TGTCACTTCTCTGGGTTCCTAGG - Intronic
961540912 3:127598643-127598665 TACCACTGACCTGGGGCCCTGGG + Intronic
962755225 3:138461128-138461150 TTCCTCTGCCTTGGGTCCCTCGG + Intronic
963078240 3:141367983-141368005 TGCCTCTGTGCTGTGGCCCTGGG - Intronic
963826162 3:149956434-149956456 TGCCACTGCCTTGGCTACCTAGG + Intronic
964674765 3:159265545-159265567 TGTCAGTGAGCTGTGTCCCTGGG + Exonic
964876164 3:161371509-161371531 TCCCACTGCGCCGGGCGCCTGGG + Exonic
965967273 3:174508396-174508418 TGCCACCGCACCCGGTCCCTGGG + Intronic
967859097 3:194138154-194138176 TGACACTGCGTTGGGGCCCACGG - Exonic
967955012 3:194871341-194871363 TGACACTGTGTTGGGTGCCTTGG - Intergenic
968811813 4:2803403-2803425 TGGCCCAGCACTGGGTCCCTAGG - Intronic
969045588 4:4334253-4334275 TGCCTCTGTGCTGGGTCTTTGGG + Intergenic
969524445 4:7697040-7697062 GGCTGCTGCGCTGGGGCCCTGGG - Intronic
971019024 4:22515946-22515968 TGCGGCTGCGCTGGGCCTCTAGG + Exonic
972359913 4:38317239-38317261 GGCCACTCAGCTGGTTCCCTAGG - Intergenic
973374203 4:49276495-49276517 AGCCCCTGCGCTGGGCCCCGGGG + Intergenic
973374306 4:49276929-49276951 AGCCCCTGCGCTGGGCCCCCTGG + Intergenic
973383105 4:49333310-49333332 AGCCCCTGCGCTGGGCCCCCTGG - Intergenic
973383209 4:49333744-49333766 AGCCCCTGCGCTGGGCCCCGGGG - Intergenic
973386710 4:49518326-49518348 AGCCCCTGCGCTGGGCCCCCTGG - Intergenic
974456074 4:62130733-62130755 TGTGGCTGCTCTGGGTCCCTGGG - Intergenic
976873863 4:89830665-89830687 AGCCACTGTGTTGGGGCCCTTGG - Intronic
979191354 4:117862961-117862983 AGCCACCGCGCCTGGTCCCTGGG - Intergenic
982032249 4:151312564-151312586 TGCCACTGCTGGTGGTCCCTGGG - Intronic
982633557 4:157864096-157864118 CGCCACTGAGCTGGGACCCCTGG - Intergenic
985689138 5:1297449-1297471 TGCCCCTGCAGTGGGTCCCATGG + Intergenic
987303297 5:16616568-16616590 TCCCCCTGCACTGGGTCCCCGGG + Intronic
991980231 5:72222723-72222745 TGCCAATTCTCTGGGTACCTTGG + Intronic
992650514 5:78855126-78855148 AGCCACTGCTCTGTTTCCCTGGG + Intronic
994206979 5:97046291-97046313 TGCTACTGAGCTGGGTCGCAGGG - Intergenic
995713216 5:115055369-115055391 TGCCACTGCTGTGTCTCCCTTGG - Intergenic
996493779 5:124129698-124129720 TGCCACTGTGAGGGGTTCCTGGG + Intergenic
997085265 5:130789858-130789880 AGCCACTGCGCCTGGTCACTGGG - Intergenic
997690161 5:135822939-135822961 TGGCCCTGAGCTGGGTCTCTGGG + Intergenic
998287019 5:140872078-140872100 TGCCACTGCACTTAGTCCATTGG + Intronic
998885184 5:146686712-146686734 TGCCAGTGCCCTGGGAACCTAGG - Intronic
1001691185 5:173633739-173633761 TGCCAGTGTGCTGGGTTGCTGGG - Intergenic
1001764464 5:174234506-174234528 TGCCTCTGGGCTGGGTCACTTGG + Intronic
1002394391 5:178941691-178941713 TGCCGCTTCGCCAGGTCCCTCGG - Intronic
1002473662 5:179452163-179452185 TGCTTCTGTTCTGGGTCCCTTGG - Intergenic
1002491979 5:179584848-179584870 AGCCACTGCGCCCGGTCCCAAGG - Intronic
1002871011 6:1167229-1167251 GGCCTCTTCGCTGGGGCCCTTGG - Intergenic
1006502295 6:34466482-34466504 TGCCACTGCGCTGGGTCCCTTGG + Intronic
1006514517 6:34538544-34538566 GGCCTCTGCACGGGGTCCCTTGG - Intronic
1006627461 6:35407356-35407378 CGCCACTGCGCTGTGGCTCTCGG + Intronic
1006897683 6:37481286-37481308 TGGCACTGGGATGGGGCCCTAGG - Exonic
1011075266 6:83431392-83431414 TGCCCCCGCCCTGGGTCTCTGGG - Intergenic
1013323905 6:109025030-109025052 TGCTGCTGCTCTAGGTCCCTGGG - Intronic
1015924395 6:138294721-138294743 TGCCAATGCTTTGGGACCCTTGG - Intronic
1016126726 6:140412741-140412763 TCCCACTGCCCTCTGTCCCTTGG + Intergenic
1016720269 6:147288389-147288411 TACCACTGAGCTGGGTAGCTAGG + Intronic
1017842406 6:158232394-158232416 TGCCCCTGCGGTGGGCCCCGGGG + Intronic
1019481784 7:1270276-1270298 TGTCACTGGGCCGCGTCCCTGGG + Intergenic
1019989886 7:4683342-4683364 TCCCACTGGCCTGGATCCCTGGG + Intronic
1020136883 7:5592685-5592707 GGCCGCAGCGCCGGGTCCCTCGG + Intergenic
1023046916 7:36218135-36218157 TGGCTCTGCCCTGGGCCCCTAGG - Intronic
1024325915 7:48109151-48109173 TGCCCCTGAGCTGGGGACCTAGG - Intergenic
1026546162 7:71324363-71324385 AGCCACTGTGCTGGGCCTCTTGG - Intronic
1026973206 7:74480375-74480397 TGCCCCTGCACTGGGGCCCCTGG - Intronic
1029597729 7:101546603-101546625 TGGCATTGCCCTGGGGCCCTGGG + Intronic
1031969337 7:128052802-128052824 TGTTACTTCGATGGGTCCCTTGG + Intronic
1031982267 7:128135726-128135748 TTCCACTTGGCTCGGTCCCTGGG - Intergenic
1032530367 7:132615133-132615155 CGCCCCTGTGCCGGGTCCCTAGG - Intronic
1033062520 7:138122310-138122332 TGCCACAGCGCTCGGCCTCTTGG - Intergenic
1034066932 7:148146019-148146041 TGCCTCTGTGTTGGGCCCCTTGG - Intronic
1035298420 7:157880543-157880565 TGCCTATGGGCCGGGTCCCTTGG - Intronic
1035890920 8:3341654-3341676 TGCCCCTGCTATGGCTCCCTGGG - Intronic
1040276744 8:46017746-46017768 AGCCTCTGCACTGGGTCCATGGG - Intergenic
1040715570 8:50247807-50247829 AGCCACTGTGCTTGGTCCCATGG + Intronic
1041731562 8:61068423-61068445 TGGCACTGTGCTGGGTGCGTAGG + Intronic
1042370406 8:67984938-67984960 TGCGACTGGGCTGGGTGCCTGGG - Intronic
1045281750 8:100755268-100755290 TTCCACTGTTCTTGGTCCCTAGG + Intergenic
1049429640 8:142554559-142554581 TGCCTCTGAGCTGCTTCCCTGGG - Intergenic
1049513885 8:143043504-143043526 TGCCACAACCCTGGTTCCCTGGG - Intronic
1049545233 8:143227747-143227769 TGCCACTGGGCCAGGTCCCATGG - Intergenic
1049627373 8:143631327-143631349 TGCCTCTGAGCTGCTTCCCTGGG - Intergenic
1049970144 9:814974-814996 AGCCACTGTGCTGGGCCCCTTGG - Intergenic
1050979881 9:11996777-11996799 AGCCACTGCTCTGTTTCCCTAGG - Intergenic
1052853871 9:33394959-33394981 TGCCTCTGAGCTGGGAGCCTGGG - Intronic
1053643825 9:40109971-40109993 AGCCCCTGCGCTGGGCCCCATGG + Intergenic
1053644017 9:40110788-40110810 AGCCACTGCGCTTGGCCCCATGG + Intergenic
1053681894 9:40491109-40491131 TGCCTCTGAGCTGGGAGCCTGGG - Intergenic
1053762136 9:41354692-41354714 AGCCACTGCGCTTGGCCCCATGG - Intergenic
1053762326 9:41355518-41355540 AGCCCCTGCGCTGGGCCCCATGG - Intergenic
1053931883 9:43119438-43119460 TGCCTCTGAGCTGGGAGCCTGGG - Intergenic
1054281820 9:63133823-63133845 TGCCTCTGAGCTGGGAGCCTGGG + Intergenic
1054294986 9:63326612-63326634 TGCCTCTGAGCTGGGAGCCTGGG - Intergenic
1054324680 9:63707199-63707221 AGCCCCTGCGCTGGGCCCCATGG + Intergenic
1054324873 9:63708017-63708039 AGCCACTGCGCTTGGCCCCATGG + Intergenic
1054350728 9:64015577-64015599 AGCCCCTGCGCTGGGCCCCGGGG - Intergenic
1054393011 9:64631112-64631134 TGCCTCTGAGCTGGGAGCCTGGG - Intergenic
1054427660 9:65136322-65136344 TGCCTCTGAGCTGGGAGCCTGGG - Intergenic
1054502716 9:65885216-65885238 TGCCTCTGAGCTGGGAGCCTGGG + Intronic
1054540731 9:66265812-66265834 AGCCACTGCGCTTGGCCCCATGG - Intergenic
1054540921 9:66266637-66266659 AGCCCCTGCGCTGGGCCCCATGG - Intergenic
1056933230 9:90895905-90895927 TTCCACTTCTCTGGGTCCCGGGG + Exonic
1057317546 9:93979467-93979489 TGCCAATGAGCTGGGGGCCTCGG - Intergenic
1058885072 9:109316814-109316836 AGCCACTGCGCTTGGCCCCTGGG - Intronic
1059960312 9:119558286-119558308 TGGCACTGTGCTGGGCCCCTAGG - Intergenic
1060402014 9:123354819-123354841 TGCCACAGCCCTGGGTCCCCAGG - Intergenic
1061176686 9:129001879-129001901 AGCCACTGCTGTGGCTCCCTGGG - Exonic
1062091840 9:134682455-134682477 TGGCACTGGGCTGGCTCCGTCGG - Intronic
1062434334 9:136540039-136540061 TGCCACTGCTGTGTGACCCTGGG + Intronic
1062454436 9:136629048-136629070 TGTCACTGCGCAGGTTCCCACGG + Intergenic
1203698308 Un_GL000214v1:116288-116310 AGCCACTGCGCTTGGCCCTTTGG + Intergenic
1203551229 Un_KI270743v1:166149-166171 AGCCCCTGCGCTGGGCCCCCTGG - Intergenic
1186459595 X:9737722-9737744 AGCCACTGCACCTGGTCCCTTGG - Intronic
1187326383 X:18294692-18294714 TGCCACTTCGCTGGGTCTAATGG - Intronic
1191638466 X:63403552-63403574 AGCCACTGCACCTGGTCCCTTGG + Intergenic
1192444299 X:71199035-71199057 AGCCACTGCGCCTGGCCCCTGGG - Intergenic
1192607871 X:72538467-72538489 AGCTACTGCTCTCGGTCCCTTGG + Intronic
1196217534 X:113071547-113071569 TGCCACTGAGCTGGCACCCAGGG + Intergenic
1196847396 X:119907170-119907192 TGCCACTGCACTGCAGCCCTGGG - Intronic
1199699097 X:150363423-150363445 TGCAACAGGGCTGGGTTCCTTGG + Exonic
1200063013 X:153491940-153491962 TGCCACTGCACAGGCCCCCTAGG - Intronic