ID: 1006503441

View in Genome Browser
Species Human (GRCh38)
Location 6:34472936-34472958
Sequence AACCCCATGAGCTTACTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 54}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006503441_1006503442 -4 Left 1006503441 6:34472936-34472958 CCTCTTAGTAAGCTCATGGGGTT 0: 1
1: 0
2: 0
3: 6
4: 54
Right 1006503442 6:34472955-34472977 GGTTATCCCCATTTTACAGATGG 0: 2
1: 24
2: 211
3: 762
4: 2018
1006503441_1006503443 -3 Left 1006503441 6:34472936-34472958 CCTCTTAGTAAGCTCATGGGGTT 0: 1
1: 0
2: 0
3: 6
4: 54
Right 1006503443 6:34472956-34472978 GTTATCCCCATTTTACAGATGGG 0: 12
1: 115
2: 481
3: 1422
4: 2731
1006503441_1006503448 26 Left 1006503441 6:34472936-34472958 CCTCTTAGTAAGCTCATGGGGTT 0: 1
1: 0
2: 0
3: 6
4: 54
Right 1006503448 6:34472985-34473007 GAAGTTAAGTGACTTGCCTGAGG 0: 1
1: 32
2: 239
3: 1034
4: 3129
1006503441_1006503444 -2 Left 1006503441 6:34472936-34472958 CCTCTTAGTAAGCTCATGGGGTT 0: 1
1: 0
2: 0
3: 6
4: 54
Right 1006503444 6:34472957-34472979 TTATCCCCATTTTACAGATGGGG 0: 248
1: 1293
2: 3924
3: 8101
4: 13354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006503441 Original CRISPR AACCCCATGAGCTTACTAAG AGG (reversed) Intronic
901184490 1:7363987-7364009 AGCCCCATCAGCTTACAGAGAGG + Intronic
904983887 1:34528570-34528592 AACCCCATATGCTTAGTAAATGG - Intergenic
905763970 1:40584838-40584860 AACAGCATCAGCTTAATAAGGGG + Intergenic
912331291 1:108822332-108822354 AACTCCATTAGCTAACTAAGGGG - Intronic
921311377 1:213847218-213847240 AATCCCATGTGCCTACTAAGTGG - Intergenic
1074849964 10:117431953-117431975 CACCTCATGAGCTTGCTATGGGG - Intergenic
1075166121 10:120069795-120069817 AACCCCATGGGGTTACTATGGGG + Intergenic
1079562367 11:21838334-21838356 AACACCAAGAGCTCACTAATTGG - Intergenic
1086736453 11:90312092-90312114 ATCCCCATGTGCTTGATAAGAGG - Intergenic
1101496803 12:105262413-105262435 TACCTCATGAGGTTACTGAGAGG + Intronic
1101642430 12:106597222-106597244 TACCCCATGAGGTTATTATGAGG - Intronic
1115370801 14:32611983-32612005 AACCCCATGAGATTAGTCAGTGG + Intronic
1121420624 14:93810904-93810926 CACCCCTTGAGCTGACTCAGGGG - Intergenic
1128630353 15:69259347-69259369 AACCCCATAAGTTTAATAAATGG - Intronic
1135848924 16:25944635-25944657 CACCCCATGAGCTACCTAACAGG + Intronic
1136545438 16:30951728-30951750 GACCCCATGACCTTTCCAAGGGG + Intronic
1158477341 18:57791897-57791919 AACCCCATAAGCTCCCTGAGGGG + Intronic
1164271074 19:23672211-23672233 AAACCCAAGAGCTAACTAACTGG - Intronic
1164442819 19:28292204-28292226 AACCCCATGGCCTTAGCAAGTGG - Intergenic
1167828990 19:52002368-52002390 AACCCCACCAGCTTCCTATGTGG - Intronic
937804840 2:126127303-126127325 AATCCCATCAGCTTTCCAAGCGG + Intergenic
939130309 2:138227844-138227866 AACAGCATGAGATTACTAAGGGG - Intergenic
939248572 2:139657709-139657731 ACCCCCATGTGCTTAGTAATTGG + Intergenic
939859389 2:147399202-147399224 AATCCCATGTGCTAACAAAGTGG - Intergenic
1170117708 20:12878469-12878491 GACCCCATGAGGTTTCTAAGGGG - Intergenic
949202664 3:1397860-1397882 AACCCCATGCTGTTACTTAGAGG + Intronic
952552181 3:34491656-34491678 AAGACCATGAGCTTACAGAGGGG - Intergenic
953585486 3:44196961-44196983 AACACGATGAGTTTACTAATAGG - Intergenic
956602260 3:71034496-71034518 TACCCCATAAGGTTACTATGAGG + Intronic
959299267 3:104577641-104577663 AACCCCTGGAGCTAACTTAGGGG - Intergenic
960615331 3:119591131-119591153 AACCCATGGAGCTTCCTAAGGGG - Intergenic
962812372 3:138970797-138970819 AACCCCATCTGCGTGCTAAGAGG - Intergenic
965309348 3:167109933-167109955 CACACCATGCTCTTACTAAGAGG + Intergenic
965666591 3:171100631-171100653 AACACCTTGTGCTTACTAGGTGG + Intronic
970394375 4:15651283-15651305 AAACCCATGGGCTTCCGAAGGGG + Intronic
970657294 4:18245671-18245693 AACCTCATGAGGTTACCATGAGG + Intergenic
972874387 4:43340569-43340591 AACCCCAGCAGTTTACTAAAGGG - Intergenic
973844533 4:54897659-54897681 AACCACATTTGCTTACTAATGGG + Intergenic
974889372 4:67861316-67861338 AACCCCATGAGGTAACAAATGGG - Intronic
975461974 4:74664601-74664623 AATCCCTTGAGCATACTAATTGG + Intergenic
979743932 4:124185943-124185965 AAAACCAAGAGCTTACAAAGGGG + Intergenic
990430215 5:55727477-55727499 AACCACATTCGCTTACTAATGGG + Intronic
993804433 5:92387082-92387104 AACCCCATGAGATTAATTTGGGG + Intergenic
998807641 5:145934469-145934491 AACCTCAAGAGCTTCCTTAGTGG + Intergenic
1003936259 6:10977826-10977848 AGCCCCATGAGCTGAGCAAGGGG + Intronic
1004421280 6:15472340-15472362 AACCAGCTGAGCTTAGTAAGGGG + Intronic
1006503441 6:34472936-34472958 AACCCCATGAGCTTACTAAGAGG - Intronic
1008750408 6:54727131-54727153 AACCTCATAATTTTACTAAGAGG + Intergenic
1008897547 6:56575082-56575104 AAGCCCATCAGCATACTGAGTGG + Intronic
1022028647 7:26471359-26471381 AATCCCATGAGAATGCTAAGTGG + Intergenic
1028852135 7:95549797-95549819 AACCCTAGGAGCTTCCTTAGGGG + Intergenic
1028875006 7:95812068-95812090 TACCCTCTGAGCTTACTCAGAGG + Intronic
1044550223 8:93504055-93504077 AAGCCCCTGATTTTACTAAGAGG + Intergenic
1046164368 8:110411187-110411209 TACCCCATAATCTTACTAGGTGG + Intergenic
1049059088 8:140262144-140262166 AAGCCAGTGAACTTACTAAGGGG - Intronic
1059516958 9:114904961-114904983 TCCCCCATGTGCTTATTAAGGGG + Intronic
1187089458 X:16080062-16080084 AGCCACATGAGCTTACTTACAGG + Intergenic
1187411793 X:19057336-19057358 AACCCCATGATCTTTGTAGGAGG - Intronic
1193242992 X:79194835-79194857 AACCCCAAGAGCCCACTTAGTGG - Intergenic
1196152489 X:112390682-112390704 AACCCCATCAGGTTACCAAAGGG - Intergenic
1199390486 X:147272069-147272091 AACACCATGACCATACTAAAAGG + Intergenic