ID: 1006505002

View in Genome Browser
Species Human (GRCh38)
Location 6:34483468-34483490
Sequence GACCCAACTCTGGTGCCCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 139}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006505002_1006505008 7 Left 1006505002 6:34483468-34483490 CCGGTGGGCACCAGAGTTGGGTC 0: 1
1: 0
2: 1
3: 9
4: 139
Right 1006505008 6:34483498-34483520 AGTTCCTACTGCTCCTCTAGGGG No data
1006505002_1006505011 23 Left 1006505002 6:34483468-34483490 CCGGTGGGCACCAGAGTTGGGTC 0: 1
1: 0
2: 1
3: 9
4: 139
Right 1006505011 6:34483514-34483536 CTAGGGGTCCTCACCCCAGCTGG 0: 1
1: 0
2: 3
3: 7
4: 121
1006505002_1006505007 6 Left 1006505002 6:34483468-34483490 CCGGTGGGCACCAGAGTTGGGTC 0: 1
1: 0
2: 1
3: 9
4: 139
Right 1006505007 6:34483497-34483519 CAGTTCCTACTGCTCCTCTAGGG No data
1006505002_1006505006 5 Left 1006505002 6:34483468-34483490 CCGGTGGGCACCAGAGTTGGGTC 0: 1
1: 0
2: 1
3: 9
4: 139
Right 1006505006 6:34483496-34483518 TCAGTTCCTACTGCTCCTCTAGG 0: 1
1: 0
2: 0
3: 27
4: 229
1006505002_1006505012 24 Left 1006505002 6:34483468-34483490 CCGGTGGGCACCAGAGTTGGGTC 0: 1
1: 0
2: 1
3: 9
4: 139
Right 1006505012 6:34483515-34483537 TAGGGGTCCTCACCCCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006505002 Original CRISPR GACCCAACTCTGGTGCCCAC CGG (reversed) Intronic
900386487 1:2413196-2413218 GACGCCCCCCTGGTGCCCACGGG + Intronic
900936885 1:5771635-5771657 GCCCCACCTCTGGTTCCCACTGG - Intergenic
900980496 1:6043507-6043529 GCCCCAATTCTGGTGCCCACAGG + Intronic
901319234 1:8329727-8329749 GACCCATCTGTGGTCACCACAGG + Intronic
901639205 1:10684916-10684938 CTCCCAACTCAGCTGCCCACGGG + Intronic
901795389 1:11676681-11676703 GACCCATCTCAGCTGCTCACAGG + Intronic
906815650 1:48875475-48875497 TACCCCACTCTGCTTCCCACTGG - Intronic
910268769 1:85369891-85369913 GGACCAACTCTGTTGCCCATAGG + Intronic
915737320 1:158093347-158093369 GCCCCAGCTATGATGCCCACAGG - Exonic
916809271 1:168291339-168291361 CCCCCAACTTTGGGGCCCACTGG + Exonic
918178664 1:182067527-182067549 AACCCACCTCTGGTCTCCACTGG + Intergenic
921273397 1:213492217-213492239 GACCCCACTCGGGTGGCCACAGG + Intergenic
922391388 1:225146861-225146883 GAGCAAACTCTGATGCTCACAGG - Intronic
1063914782 10:10870548-10870570 GACCCAACTCTGGGTCTCAGAGG - Intergenic
1067426872 10:46217250-46217272 GCCCCACCGCTGTTGCCCACAGG - Intergenic
1067555179 10:47264683-47264705 GACCAAGCCCTGGTGACCACAGG + Intergenic
1070779486 10:79129403-79129425 GGCCCCACTCTGAAGCCCACAGG + Intronic
1070895454 10:79980193-79980215 TTCCCAGCTCTGGTGGCCACAGG + Intronic
1074643718 10:115419502-115419524 GACCAAACTATGCTGCCTACAGG + Intronic
1075066853 10:119294575-119294597 GACCCAAATCTCCTGACCACTGG - Intronic
1075978869 10:126720116-126720138 AAGCCCACTCTGGTTCCCACGGG - Intergenic
1076539862 10:131207084-131207106 GGCGCAACTCTGCTGGCCACTGG + Intronic
1078983114 11:16561278-16561300 GAGCCCACTGTGGTGCCCAGAGG - Intronic
1079723195 11:23845824-23845846 GTCCCAGCTGTGGTGGCCACAGG - Intergenic
1080410383 11:32018588-32018610 GAACCAACTCAGGTGGCCAGCGG - Intronic
1082823745 11:57562562-57562584 GTCCCAATTCTGGTGACCATGGG + Intronic
1084161216 11:67351363-67351385 GAGCGACCTCTGGTGCCCCCTGG - Intronic
1084489466 11:69470721-69470743 GACCCAAATCTCTTTCCCACGGG - Intergenic
1085198221 11:74684828-74684850 GACCCCACTCCTCTGCCCACAGG - Intergenic
1092476978 12:8828014-8828036 GTCCCAATGCTGGTGGCCACAGG - Intronic
1096917730 12:55051332-55051354 GACCCAGCTCTCCTGCTCACAGG - Intergenic
1099394346 12:82119773-82119795 GAATCAACTTAGGTGCCCACTGG - Intergenic
1100854723 12:98748831-98748853 GACCTTACCCTGGTCCCCACAGG - Intronic
1104067004 12:125314465-125314487 GCACCACCTCTGGGGCCCACAGG - Intronic
1104358017 12:128105694-128105716 TGCACAGCTCTGGTGCCCACGGG + Intergenic
1104872875 12:132013320-132013342 GACCCAGCTCTGGGGCTCTCTGG - Intronic
1105813469 13:24013395-24013417 GTCCCAGCTCTGGGGCCCATGGG + Intronic
1105834495 13:24197068-24197090 TACCCATCTCAGGTGCCCTCTGG - Intronic
1108622072 13:52194492-52194514 TACCCACCCCTGTTGCCCACCGG - Intergenic
1108664632 13:52617423-52617445 TACCCACCTCAGTTGCCCACCGG + Intergenic
1110091052 13:71448858-71448880 GACCCAACTCTGTAGGCCTCAGG - Intronic
1119676968 14:76562977-76562999 GACCCCACTCTCATGCCCACGGG - Intergenic
1121144845 14:91574536-91574558 GACCCAGCTCTTCTGCTCACTGG - Intergenic
1121231462 14:92361950-92361972 CACCCTATTCTGGTGCCCAGAGG + Intronic
1121734893 14:96211351-96211373 ACCCCCACTCTGGAGCCCACTGG + Intronic
1122641035 14:103159563-103159585 GACCCAGCCCTTGTGCCCAAGGG - Intergenic
1123995371 15:25714294-25714316 GGCCCCACCCTGGTTCCCACAGG + Intronic
1126660726 15:51030762-51030784 TTCCCAACTTTGGTGGCCACAGG - Intergenic
1128405861 15:67337862-67337884 GACCCAAAGCTGGTTCCCAAAGG + Intronic
1129882084 15:79013692-79013714 GCCCCAACCCTGGAGCCCACTGG - Intronic
1130146583 15:81278914-81278936 GACCAAACTCTGGGGCCTTCAGG + Intronic
1130905476 15:88237467-88237489 GACACAAGTGTGGTGCTCACTGG + Intronic
1131081867 15:89543396-89543418 GAAACAACTCTGCTGCCCATAGG + Intergenic
1139264118 16:65623328-65623350 GGCCCACCTCAGGTGCACACTGG - Intergenic
1140646375 16:77035643-77035665 GACCCAACACTGGAGCACCCAGG - Intergenic
1141710607 16:85696822-85696844 GATCCAACCCAGGTGGCCACAGG + Intronic
1142282339 16:89155035-89155057 GACCCAGCTCCGGAGCCCACAGG + Exonic
1149678383 17:58487265-58487287 GACTCCACTCTGCTTCCCACGGG + Intronic
1152657557 17:81527138-81527160 TGCCCACCTCTGGAGCCCACAGG + Intergenic
1152939656 17:83161501-83161523 GACCCAGCCCTGGTGCACAGTGG - Intergenic
1154323599 18:13374288-13374310 GACCCAGCTCTGGCCTCCACAGG - Intronic
1157984940 18:52426429-52426451 GATATAACTCTTGTGCCCACTGG - Intronic
1159929290 18:74295106-74295128 TCCCCAATTCTGGTGCCAACTGG + Intergenic
1159942767 18:74421120-74421142 AACCTCACTCTGGTGCCAACTGG + Intergenic
1161379201 19:3955827-3955849 GCCCCATCTCAGGTGCCCAGAGG + Intergenic
1161599202 19:5170568-5170590 GACCTGACTCAGGTGCTCACAGG + Intronic
1161621385 19:5299129-5299151 GACCTGACTCAGGTGCACACCGG - Intronic
1161633247 19:5370072-5370094 GACCTGACTCAGGTGCTCACAGG - Intergenic
1162792674 19:13071128-13071150 GTCCCCACTCTGCTGCCCAGGGG - Intronic
1163668153 19:18612700-18612722 GACACCTCCCTGGTGCCCACGGG - Intronic
1166360273 19:42250243-42250265 GACCCAATGCTTGTTCCCACAGG + Intronic
1166473298 19:43098842-43098864 ACCCCAGCACTGGTGCCCACTGG + Intronic
929114628 2:38433915-38433937 TACTCAATTCTGGGGCCCACAGG + Intergenic
931417985 2:62099496-62099518 AACCCAGCTGTGGTGCCCACTGG + Intronic
932500710 2:72180548-72180570 GGCCCAACTCTGGTGAAGACTGG - Intronic
933277774 2:80302170-80302192 GACCCCAGCCTGGTGCCCGCCGG + Exonic
934736119 2:96690708-96690730 GACCCAGCTCTGGAGGCCAGGGG - Intergenic
934756899 2:96830579-96830601 CACCCAGATCTGGAGCCCACAGG - Intronic
936392183 2:112085426-112085448 GACCCAATTCTAGTTCCCCCAGG + Intronic
936582017 2:113708876-113708898 GTCCCTACTCTGTTGCCCCCTGG - Intronic
942882263 2:180875060-180875082 CACCCAACACTGGAGCACACAGG + Intergenic
944616416 2:201465173-201465195 TTCCCAACTGTGGTGGCCACAGG - Intronic
946226559 2:218266926-218266948 GACTCCACTCTAGTGGCCACAGG - Exonic
947976741 2:234373209-234373231 AAACCAACTCTTCTGCCCACGGG - Intergenic
948675796 2:239595887-239595909 GACCCAATCCTTGTACCCACGGG + Intergenic
948802940 2:240441011-240441033 TACCCTATTCAGGTGCCCACAGG + Intronic
949002872 2:241627534-241627556 AACCCACCTCTGAAGCCCACTGG + Intronic
1172029175 20:31969303-31969325 GACCCAACTGGGGAGCCCTCAGG + Intronic
1175852259 20:62099896-62099918 GACCCACCTCTGCTTCCCATGGG + Intergenic
1177121144 21:17138443-17138465 TACCCCAGTTTGGTGCCCACTGG - Intergenic
1178892844 21:36534396-36534418 GACCTTGCTCTGGTTCCCACGGG - Intronic
1181160609 22:20957616-20957638 GGCCCAACTCTCGTGGCCCCTGG + Intergenic
1181882038 22:25988883-25988905 ATCCCAACTCTGCTGCTCACTGG - Intronic
1183635593 22:39060547-39060569 TCCCCAACTCTGGCGCCAACTGG - Intronic
1183667541 22:39254259-39254281 GGCCCATCTCTGGTGCTCGCAGG + Intergenic
949648916 3:6132041-6132063 AACCAATCTCTGGTGACCACTGG + Intergenic
950191094 3:10976650-10976672 GACCTTGCTCTGGTGCCCAGGGG - Intergenic
950462839 3:13135519-13135541 GCCCCAGCTCTGGTGCCCCTGGG + Intergenic
952765820 3:36953242-36953264 CACCCAACTAGGGTGTCCACAGG + Intergenic
955826324 3:62951573-62951595 GCCCCAACACAGGTCCCCACCGG + Intergenic
956172757 3:66445539-66445561 CACACACCTATGGTGCCCACAGG + Intronic
968005720 3:195241288-195241310 GACCCCACTATGGGCCCCACAGG + Intronic
968650924 4:1760005-1760027 CTCCCAACTCTGGTGCCCCCAGG + Intergenic
969933811 4:10660960-10660982 GAACCAACTCTCGGGCCAACTGG - Intronic
971061370 4:22975252-22975274 TACCCAACACTGGAGCACACAGG - Intergenic
978102604 4:104861013-104861035 GACCCAAGTTTGATGCTCACTGG - Intergenic
984936326 4:184892587-184892609 GATCCCACTCTGGGGCCCTCAGG - Intergenic
985479029 5:95751-95773 GACCCACCTCTAGTGTCCAATGG + Intergenic
986940901 5:12947998-12948020 AACCCAACCCTGGTTCCCATGGG - Intergenic
989037025 5:37185142-37185164 GACCCAACTCTGGTCCCTCCTGG + Intronic
995685604 5:114768620-114768642 AACCCAACTCTGGTGCTCTAAGG + Intergenic
996747131 5:126854880-126854902 CGCCCAACCCTGGTTCCCACCGG + Intergenic
997408938 5:133675499-133675521 GCCCCAACACCAGTGCCCACAGG + Intergenic
997453495 5:134001925-134001947 GACCCAGCTGAGGAGCCCACTGG + Intronic
999685668 5:154100790-154100812 AACCCAGTTTTGGTGCCCACTGG - Intronic
1003318045 6:5029091-5029113 GACACAACCCTGATGTCCACGGG + Intergenic
1006407229 6:33852298-33852320 GACCCAAGGCTGGTGCCTCCAGG - Intergenic
1006505002 6:34483468-34483490 GACCCAACTCTGGTGCCCACCGG - Intronic
1007478354 6:42134035-42134057 GCCACAACTCTGCTGCCCTCTGG - Intronic
1011994549 6:93568604-93568626 GACACAAGTCTGGTATCCACTGG - Intergenic
1017849384 6:158290890-158290912 CACCCAGCTCTGCTGCCTACCGG + Intronic
1018726505 6:166616800-166616822 GAGCCCACTGTGGTGCCCATGGG + Intronic
1019145906 6:169975515-169975537 CAGCCTCCTCTGGTGCCCACAGG + Intergenic
1020279976 7:6645197-6645219 AACTCAACTCAGGTTCCCACTGG + Intronic
1028181586 7:87730797-87730819 GTCCCAATACTGGTGCTCACAGG + Intronic
1032017576 7:128389584-128389606 GGGCCATCTCTGGTGCCCCCTGG - Intergenic
1034101705 7:148456660-148456682 GTCCAGACACTGGTGCCCACAGG - Intergenic
1036504754 8:9345105-9345127 AACCCAACCCTTCTGCCCACTGG - Intergenic
1037567804 8:20132214-20132236 GGCCCAAGTCTGGTGCCATCAGG + Intergenic
1038143517 8:24872044-24872066 AACCCAGCTCTGGGGGCCACTGG + Intergenic
1038483373 8:27917059-27917081 GGCCCAACTCTGCTGGCCCCTGG + Intronic
1041784486 8:61616369-61616391 GCCCCAAATCTGCTGCTCACAGG - Intronic
1041905752 8:63031735-63031757 GTCACAACTCTGGTGCCTAGGGG + Intronic
1042428282 8:68673866-68673888 GTCCCAGCTGTGGTGACCACAGG + Intronic
1042567439 8:70126746-70126768 GACCCAACACTGGGGGACACTGG + Intronic
1042870384 8:73392659-73392681 GTCCCAGCTCTGCTGCCAACTGG + Intergenic
1044028979 8:87211068-87211090 GTCCCAAATCTGGAGCACACTGG - Intronic
1044845630 8:96377626-96377648 CACCCCACTCTGGAGGCCACTGG - Intergenic
1045601591 8:103723485-103723507 GGCCTGACTCTTGTGCCCACAGG + Intronic
1049175324 8:141189217-141189239 TTCCCAAGTCTTGTGCCCACAGG + Intronic
1049291517 8:141805469-141805491 GACTCCACTCTGGTGCACAGAGG + Intergenic
1051968256 9:22856049-22856071 GACAGAACTCTACTGCCCACTGG + Intergenic
1057624154 9:96662605-96662627 GGCTCAACTCTGGTCCCCAGGGG - Intergenic
1060737167 9:126073435-126073457 GACTCAACTCTGCTTCTCACTGG - Intergenic
1060917643 9:127400589-127400611 CACCCACCTCTGGAGCCCTCTGG - Intronic
1060959419 9:127669372-127669394 CACCCCACTCTGGAGACCACTGG + Intronic
1062378561 9:136275947-136275969 GACCCAGCTCTGGTTCCCGCTGG + Intergenic
1062419543 9:136473213-136473235 GCCCCAAGTCTGGTTCCAACTGG + Intronic
1190523114 X:51299781-51299803 GTCCCAATTGTGGTGGCCACAGG + Intergenic
1195705947 X:107738202-107738224 AACCAAACTCAGGTGCCCAGGGG - Intronic