ID: 1006506575

View in Genome Browser
Species Human (GRCh38)
Location 6:34492802-34492824
Sequence ATGGACTTCTAGAGGAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006506568_1006506575 10 Left 1006506568 6:34492769-34492791 CCCAAGGATATAAACATGGGAAT 0: 1
1: 0
2: 6
3: 43
4: 517
Right 1006506575 6:34492802-34492824 ATGGACTTCTAGAGGAGGGAAGG No data
1006506569_1006506575 9 Left 1006506569 6:34492770-34492792 CCAAGGATATAAACATGGGAATA 0: 1
1: 0
2: 4
3: 41
4: 285
Right 1006506575 6:34492802-34492824 ATGGACTTCTAGAGGAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006506575 Original CRISPR ATGGACTTCTAGAGGAGGGA AGG Intronic
No off target data available for this crispr