ID: 1006506792

View in Genome Browser
Species Human (GRCh38)
Location 6:34494315-34494337
Sequence ATTTAAGCACAGAGAGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 1, 2: 2, 3: 22, 4: 194}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006506792_1006506799 26 Left 1006506792 6:34494315-34494337 CCCAGAGCTCTCTGTGCTTAAAT 0: 1
1: 1
2: 2
3: 22
4: 194
Right 1006506799 6:34494364-34494386 ATGCACACAGGTGTCTTCTGGGG No data
1006506792_1006506800 27 Left 1006506792 6:34494315-34494337 CCCAGAGCTCTCTGTGCTTAAAT 0: 1
1: 1
2: 2
3: 22
4: 194
Right 1006506800 6:34494365-34494387 TGCACACAGGTGTCTTCTGGGGG 0: 1
1: 0
2: 2
3: 25
4: 205
1006506792_1006506795 14 Left 1006506792 6:34494315-34494337 CCCAGAGCTCTCTGTGCTTAAAT 0: 1
1: 1
2: 2
3: 22
4: 194
Right 1006506795 6:34494352-34494374 TCTCCAAGTTTAATGCACACAGG 0: 1
1: 0
2: 0
3: 13
4: 145
1006506792_1006506797 24 Left 1006506792 6:34494315-34494337 CCCAGAGCTCTCTGTGCTTAAAT 0: 1
1: 1
2: 2
3: 22
4: 194
Right 1006506797 6:34494362-34494384 TAATGCACACAGGTGTCTTCTGG 0: 1
1: 0
2: 0
3: 20
4: 130
1006506792_1006506798 25 Left 1006506792 6:34494315-34494337 CCCAGAGCTCTCTGTGCTTAAAT 0: 1
1: 1
2: 2
3: 22
4: 194
Right 1006506798 6:34494363-34494385 AATGCACACAGGTGTCTTCTGGG 0: 1
1: 0
2: 3
3: 22
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006506792 Original CRISPR ATTTAAGCACAGAGAGCTCT GGG (reversed) Intronic
900542264 1:3209039-3209061 ATTTAGGGACAGAGAGCAGTGGG + Intronic
900753789 1:4418925-4418947 ATTCAAGCACAGAGAGCCCTTGG + Intergenic
905184936 1:36189410-36189432 AATTAAGCACACAGTGCTTTGGG + Intergenic
905812053 1:40919929-40919951 GTTTTAGCACTGAGAGATCTGGG - Intergenic
911160546 1:94678883-94678905 AATTAAGGACAGAGAGTTCTGGG + Intergenic
911212261 1:95154555-95154577 AATGAAGCAGAGAGAGGTCTGGG - Intronic
913515329 1:119600550-119600572 ATTTTCCCCCAGAGAGCTCTGGG - Intergenic
916504793 1:165418669-165418691 ATTTCAGAACTGAGAGCACTAGG - Intronic
918693572 1:187513055-187513077 ATTTCAGCACAGAGAGGTTTAGG + Intergenic
920717371 1:208352995-208353017 ATTTGGACACAGAGTGCTCTGGG - Intergenic
920735859 1:208532619-208532641 ATTTCAGCACACAGAGCTCCTGG - Intergenic
920981209 1:210837286-210837308 AGCTAAGCACAGGGAGCTCTGGG - Intronic
921095383 1:211882969-211882991 CTTGGAGCACAGAGAGCTTTGGG + Intergenic
922597592 1:226825861-226825883 CTGTCAGCACAGAGAGGTCTGGG - Intergenic
922752083 1:228074998-228075020 ATTTGAGGACAGAGGGCTGTGGG + Exonic
1063067127 10:2621429-2621451 ATTACACCACAGAGAGATCTAGG + Intergenic
1064154188 10:12889989-12890011 ATTAAAGCACAGAGAAATCCAGG - Intergenic
1064171613 10:13038676-13038698 ATTTACAGACAGAGAGCTCAGGG + Intronic
1065384486 10:25120726-25120748 ATTAAAGCACAGAGACCTCAGGG - Intergenic
1067222755 10:44355870-44355892 ATGGAGGCCCAGAGAGCTCTAGG + Intergenic
1068775903 10:60867592-60867614 ATTTATGAACAGATAACTCTTGG - Intergenic
1068894413 10:62183604-62183626 ATTTAAGCACCGAGAGCTCTTGG - Intronic
1069589326 10:69632037-69632059 GTTAAAGGAGAGAGAGCTCTTGG - Intronic
1073213398 10:101822663-101822685 ATTTCAGAAGAGAGAGTTCTGGG + Intergenic
1075233199 10:120702154-120702176 ATTTAAGCCCAGAGGGCATTTGG + Intergenic
1076125790 10:127972676-127972698 ATTGAAGCACAGAGAGGTGGAGG + Intronic
1076678071 10:132158286-132158308 ATCTGAGCATAGAGAGCTCCAGG + Intronic
1078420920 11:11211969-11211991 ATTTGAGCACAGAATGCTTTTGG + Intergenic
1078671735 11:13371746-13371768 CTTCAACCACACAGAGCTCTTGG + Intronic
1078889408 11:15540546-15540568 AATTAAGCACAGGGAGGCCTGGG - Intergenic
1079994368 11:27279985-27280007 AGGAAAGCACAGAGAGCTCTAGG + Intergenic
1081753208 11:45526912-45526934 ACTGAGGCACAGAGAGCTCAAGG - Intergenic
1083181144 11:60986435-60986457 ATTTTACCTCAGAGAGCTTTGGG - Intronic
1084460327 11:69293437-69293459 CATTGAGCACAGGGAGCTCTTGG - Intergenic
1085421628 11:76366892-76366914 ATTTAAGCACCGAGAGGGCATGG - Intronic
1089305212 11:117522153-117522175 AATTAGGCACAGAATGCTCTAGG - Intronic
1091129913 11:133137095-133137117 ATTTAACAACAGGAAGCTCTGGG + Intronic
1091530792 12:1353504-1353526 ACTTAAAAACAGAGAGCTTTTGG + Intronic
1091706206 12:2695155-2695177 ATGTCAGCACAGAGAGGACTGGG + Intronic
1091711441 12:2743388-2743410 ATGTCAGCACAGAGAGGACTGGG + Intergenic
1095147135 12:38744156-38744178 AGTAAAACACAGAGAGGTCTTGG + Intronic
1097013303 12:55967887-55967909 CCTTAAGCAGAGAGATCTCTCGG - Exonic
1097617893 12:61905889-61905911 ATTGAAAAGCAGAGAGCTCTGGG - Intronic
1097637700 12:62142954-62142976 AGTGAAGCACAGAGAGGTCAAGG + Intronic
1097924284 12:65110508-65110530 ATGTATGAACACAGAGCTCTAGG - Intronic
1099152829 12:79136660-79136682 ATTTAAGCAAAAAGTGCTTTAGG - Intronic
1100913374 12:99390609-99390631 ACATAAGAAAAGAGAGCTCTGGG + Intronic
1101132902 12:101707624-101707646 ATTAAAGCACAGAGAGGGCAAGG - Intronic
1103483908 12:121269746-121269768 ATTTAAAAACAGAAAGATCTGGG + Intronic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1107595898 13:41962570-41962592 ATATAAGCACTAAGAGCTCTTGG + Intergenic
1108511091 13:51156436-51156458 ATTAAGGCACAGAGAGGTCAAGG + Intergenic
1110557280 13:76874650-76874672 ATGTGAGCACAGAGAGCTGGTGG - Intergenic
1111260429 13:85732543-85732565 ATTTAAGTACACAGAACTGTGGG + Intergenic
1111602386 13:90491512-90491534 ATGAAAGCACAGACATCTCTTGG + Intergenic
1112305572 13:98270367-98270389 TTTAGAGCACCGAGAGCTCTTGG - Intronic
1112316918 13:98371041-98371063 ATTTCAGCACGCAGAGCTCAGGG - Intronic
1121638949 14:95472638-95472660 GCTGAAGCTCAGAGAGCTCTGGG + Intronic
1123150307 14:106175111-106175133 TTATAAGCACAGAGAGCACCTGG + Intergenic
1123856800 15:24420776-24420798 AGTTAAACACAGTTAGCTCTGGG + Intergenic
1123861358 15:24470673-24470695 AGTTAAACACAGTTAGCTCTGGG + Intergenic
1125285152 15:38084557-38084579 AGGTAAGAACAGAGAGCTGTAGG - Intergenic
1126036954 15:44555575-44555597 ATCTAATTATAGAGAGCTCTTGG + Intronic
1126540548 15:49817676-49817698 ATGTAAGCACATAGAGATGTAGG - Intergenic
1127934636 15:63625322-63625344 ATGTAAGCACACAAAGCTGTTGG - Intronic
1129453284 15:75662667-75662689 AGTCAAGCACAGGGAGCTCTGGG + Intergenic
1134058592 16:11185466-11185488 ATACATGCACAGAGAGCTCATGG - Intergenic
1137420159 16:48326551-48326573 ATCTAACCACAGAGGGCCCTGGG - Intronic
1137815222 16:51392184-51392206 ATTTAAGCACACAGAGAGTTTGG + Intergenic
1140294266 16:73693134-73693156 ATACAAGGACAGAGAGCCCTTGG + Intergenic
1140801610 16:78493393-78493415 ATTTATGCACACAAAGCTTTGGG + Intronic
1141003702 16:80332240-80332262 ATTTAAGGAAAGATAACTCTGGG + Intergenic
1141920641 16:87133359-87133381 AGCTAAGCACAGTGCGCTCTGGG - Intronic
1143054614 17:4153577-4153599 TTTTATGGACAGAGAACTCTAGG + Intronic
1146939280 17:36832982-36833004 ATATATGCACAGATAGCTGTGGG - Intergenic
1151171059 17:72246697-72246719 ATTGATGGACAGGGAGCTCTGGG - Intergenic
1152859325 17:82686491-82686513 TTATAAGCACAGAGAGATTTGGG + Intronic
1157214116 18:45768090-45768112 ATCTCATCACAGATAGCTCTAGG - Intergenic
1159971567 18:74662005-74662027 ATTTAAGCACAGACACCGCATGG - Intronic
1160400918 18:78610880-78610902 ATTTAGGGACATGGAGCTCTTGG - Intergenic
1163103821 19:15112073-15112095 ATTGAAGCACAGAGAGGGATGGG - Intronic
1164983495 19:32631371-32631393 ATTTACCCACAGAGATGTCTTGG + Intronic
1168189398 19:54726858-54726880 ATTTTAGCCCAGAGAGAACTGGG + Intronic
1168463313 19:56580615-56580637 ACTGAAGCACCCAGAGCTCTTGG + Exonic
925876851 2:8318664-8318686 ACTGAAGCACGCAGAGCTCTGGG + Intergenic
926607587 2:14913268-14913290 ACTTAAGCATGGAGAGCTGTTGG + Intergenic
928985127 2:37173456-37173478 TTGTAAGTACAGAGAGTTCTGGG - Intronic
931980076 2:67685268-67685290 CTTAAAGCACAGAATGCTCTTGG + Intergenic
932836653 2:75044283-75044305 ATTTCAGCATAGAGAGCGTTGGG + Intergenic
935060924 2:99607021-99607043 ATTTAAGCACAGTTCCCTCTTGG + Intronic
935691541 2:105736383-105736405 ATTTTAGCCCAGAGAGACCTGGG + Intergenic
935692906 2:105745852-105745874 ATTTAATCACCGAGTGCTTTTGG + Intronic
936257761 2:110931557-110931579 ATTTAGGAATAGAGAGCCCTGGG + Intronic
937816150 2:126252728-126252750 ATTGAAGCTCAAAGAGCTCAAGG + Intergenic
938188404 2:129253616-129253638 ACATCAGCACAGAGAGCTCCTGG - Intergenic
938232482 2:129673472-129673494 ATCACAGCACAGAGAGCTTTGGG + Intergenic
940271813 2:151899259-151899281 ATTCAAGAGCAGAGAGTTCTTGG - Intronic
940480324 2:154220993-154221015 TTTTAAGCACATAGTGCACTGGG + Intronic
941307472 2:163889150-163889172 ATTTATGCTGAGAGATCTCTGGG - Intergenic
942137054 2:172936397-172936419 ATATAAACACACAGAGCTCTGGG - Intronic
946067462 2:217000510-217000532 ATTTTAGCACAGAGAGCTTAGGG - Intergenic
946357049 2:219193867-219193889 ATTTAAGACTAGAGATCTCTTGG - Intergenic
946870528 2:224080296-224080318 ATTTAAGCTCAGAGATCTGAAGG - Intergenic
947081516 2:226402377-226402399 ATTGAGGCACAGAGGGCTTTAGG - Intergenic
947448132 2:230180183-230180205 ATTAGAGAACAGAGAGCTCAGGG + Intronic
1170849099 20:19987861-19987883 ATTTAAACAAAGAGATCTCCTGG + Intronic
1171059659 20:21944121-21944143 TTTTAATCACTGAGAGCTCTGGG - Intergenic
1172289059 20:33762146-33762168 ATTGAAGCCCAGAGAGGTCATGG - Intronic
1172358207 20:34294263-34294285 ATCTAGGCACAGCAAGCTCTAGG + Intronic
1172507723 20:35476185-35476207 ATGTAAGCACAAAGTGCTCTGGG - Intronic
1173113256 20:40216091-40216113 AGTTATGCAAAGAGAGGTCTAGG + Intergenic
1173857746 20:46261705-46261727 AGCCAAGCACAGAGAGCTCTGGG - Intronic
1174342511 20:49906719-49906741 ATACAAGCTCAGAGAGCTCGTGG - Exonic
1174777264 20:53355861-53355883 ACTTATGCAAAGAGAGGTCTTGG + Intronic
1175007249 20:55697987-55698009 ATTTGAGCAAAGAGAGCTGGTGG + Intergenic
1176860776 21:14010562-14010584 ATGTAAGCACAGTGAGCACGCGG + Intergenic
1178006504 21:28226678-28226700 ATGTAAGCACAATGAGATCTGGG - Intergenic
1182416779 22:30226418-30226440 AGACAGGCACAGAGAGCTCTAGG + Intergenic
1182733040 22:32510676-32510698 ATTCAAGCACAGAGAGCTATAGG - Intergenic
1183316591 22:37140484-37140506 ACTGAAGCACAGAGAGCCTTAGG + Intronic
1183345363 22:37304483-37304505 ATTGAAGCTCAGGGGGCTCTGGG - Intronic
1183762509 22:39835719-39835741 ATTTTAGCCCAGTGAGCCCTGGG + Intronic
949321724 3:2819032-2819054 ATTTAAATACAGAGAGGTCTTGG + Intronic
949346363 3:3080509-3080531 AGTGAAGCACAGAGAGCTATAGG - Intronic
949409537 3:3748899-3748921 AATTATGCACAGAGGGCTATGGG + Intronic
952312920 3:32206512-32206534 ATTGAAGCACAGAGAGCTTAAGG + Intergenic
952688573 3:36176911-36176933 GTTTAAGCACAGAGGGCTGTAGG + Intergenic
953205724 3:40827106-40827128 GTTTATGGTCAGAGAGCTCTGGG - Intergenic
955113776 3:55976094-55976116 AGTTAAGAACAAAGAGATCTTGG - Intronic
955299615 3:57764722-57764744 ATTGAGGCACAGAGAGATCTTGG + Intronic
956283888 3:67588640-67588662 ATTTATGCTCAGAGCTCTCTTGG + Intronic
959667361 3:108936844-108936866 CTTTGAGCCCAGACAGCTCTTGG + Intronic
960165259 3:114394308-114394330 ATTTAGACTCAGAGAGATCTGGG - Intronic
960883038 3:122365429-122365451 ATGGAATCAGAGAGAGCTCTTGG - Intronic
962346320 3:134621188-134621210 ATTTCAGCACAAAAAGCTATTGG - Intronic
962797925 3:138864852-138864874 ATTCAGGCAAAGAGACCTCTTGG - Intergenic
964095125 3:152922440-152922462 ATTAAAGCACAGACATCTTTGGG + Intergenic
965261877 3:166497233-166497255 ATTGAAGCAAAGATTGCTCTGGG - Intergenic
965606856 3:170506356-170506378 ATTTAACCACAAATAGTTCTGGG - Intronic
966740065 3:183224396-183224418 AGATAGGCACAGAGTGCTCTGGG + Intronic
967139237 3:186539881-186539903 ATGTAAGTACAGAGAGCTGTGGG - Intronic
969196204 4:5565913-5565935 ATTTGAGCAAAGGGAGCCCTTGG + Intronic
970155560 4:13138157-13138179 CTTCAAGGACAGAGAGATCTGGG + Intergenic
970369814 4:15395350-15395372 ATTTAAAAAAAGAGTGCTCTTGG + Intronic
971238809 4:24868898-24868920 ATTAAAGCATATAGAGCTCAAGG - Intronic
975323971 4:73039206-73039228 ATTTATGCTAACAGAGCTCTGGG - Intergenic
977874662 4:102134796-102134818 ATTTAACCCCAGAGAGCACCGGG - Intergenic
978257277 4:106707994-106708016 ATAAAAGTCCAGAGAGCTCTTGG - Intergenic
978411193 4:108427818-108427840 ATTGAAGCACAGAGGGTTTTAGG + Intergenic
978699943 4:111630336-111630358 CCTCAAGCACAGAGAGTTCTAGG + Intergenic
978831459 4:113090470-113090492 ATTTAAGAACAGATAGTTCAGGG - Intronic
979576602 4:122299389-122299411 ATTTAAGGAAAGTGAGCTCAAGG + Intronic
982811286 4:159828847-159828869 ATGTGAGCACAGAGAATTCTTGG + Intergenic
983256370 4:165404976-165404998 TTTTAAGCACAGAGTGCTAAAGG - Intronic
984872297 4:184336543-184336565 ATTTGTGCACACAGAGTTCTAGG + Intergenic
985908863 5:2863763-2863785 ATGGAGGCACAGAGAGCTGTGGG + Intergenic
990086338 5:51982778-51982800 ATTTTAGCAGAGATATCTCTCGG + Intergenic
990629124 5:57648608-57648630 ATACAAGCTCAGAGAACTCTAGG - Intergenic
993091323 5:83430109-83430131 ATATATGCACAGTGAGTTCTAGG - Intergenic
994211541 5:97092310-97092332 ATTTAAACACATGAAGCTCTGGG - Exonic
995449772 5:112287767-112287789 ATTAAAGCAGAGAAAGCTATTGG + Intronic
995709923 5:115025021-115025043 CTGAAAGCACAGAGAGCACTTGG + Intergenic
996414502 5:123195570-123195592 TTTTAAGGACAGGGTGCTCTGGG + Intergenic
996738885 5:126780943-126780965 CCTTAAGCAAAGAGAACTCTAGG - Intronic
997581915 5:135023402-135023424 TTTTCAGCACAGGCAGCTCTTGG - Intergenic
997653574 5:135539270-135539292 ATTTAAGGAAAGAGAGGACTGGG + Intergenic
998299803 5:141006961-141006983 ATTGGAGCACAGAGAGATGTGGG + Intronic
999045918 5:148469367-148469389 ATTTAAGCACAGTGTGCACAAGG - Intronic
999680272 5:154051981-154052003 GTTAAAGCACAGAGTGCTTTGGG + Intronic
1000139830 5:158391633-158391655 ATTTGTGCACAGAGAACACTTGG - Intergenic
1000523395 5:162325657-162325679 CTTTGAGCACAGAGACCTCTTGG + Intergenic
1002304123 5:178273462-178273484 ATTTGTGATCAGAGAGCTCTGGG + Intronic
1002311851 5:178319796-178319818 ATTTCAGCACTGAGAGCCCAGGG - Intronic
1003501229 6:6704554-6704576 ATTTATGCCCAGAGGCCTCTGGG - Intergenic
1006506792 6:34494315-34494337 ATTTAAGCACAGAGAGCTCTGGG - Intronic
1007557868 6:42782294-42782316 GTTTCAGCCCAGAGAGCTATTGG + Intronic
1008417468 6:51259516-51259538 ATTTAAGCACTAAGACATCTAGG + Intergenic
1008831832 6:55774005-55774027 AGTTATGCACAGAGAGTTATGGG - Intronic
1012764865 6:103354924-103354946 TTTGAAGCTCAGATAGCTCTAGG - Intergenic
1013776640 6:113686176-113686198 ATGAAAGTACAGAGAGTTCTTGG + Intergenic
1016960067 6:149664915-149664937 AGCTGAGCACAGAGAGCTCTAGG + Intronic
1018399119 6:163404806-163404828 ATTCTAGCACAGAGAGTTGTGGG - Intergenic
1019148136 6:169987492-169987514 GCTTGAGCACAGCGAGCTCTGGG + Intergenic
1024513957 7:50227764-50227786 ATCTAAGCAAAGCGAGCACTTGG + Intergenic
1026183794 7:68065182-68065204 ATTTAAGCCCAGTTAACTCTTGG + Intergenic
1027414210 7:77957923-77957945 ATTTAAGCCCAGTGAACACTTGG - Intergenic
1028310621 7:89329304-89329326 GTTTAAGCAGAGAGAGCAATTGG - Intronic
1028486646 7:91365770-91365792 ATTAAAGCAAAGAGAGCAATCGG + Intergenic
1030570940 7:111223419-111223441 AATTAAGCACAATGAACTCTAGG + Intronic
1033581640 7:142742450-142742472 ATTTAATAACAGAATGCTCTGGG - Intergenic
1035618302 8:1018574-1018596 CTTTAAGCACACATTGCTCTTGG + Intergenic
1036275004 8:7342997-7343019 TCTTCAGCACAAAGAGCTCTTGG - Intergenic
1036346350 8:7967351-7967373 TCTTCAGCACAAAGAGCTCTTGG + Intergenic
1036739952 8:11351135-11351157 ATATAGGCACAGAAAACTCTGGG - Intergenic
1036841673 8:12128105-12128127 TCTTCAGCACAAAGAGCTCTTGG + Intergenic
1036925053 8:12896306-12896328 AGATCAGCACAGAGAGCTCCAGG - Intergenic
1040696889 8:50010327-50010349 ACTGAAGCACAGAGAGCTTCAGG + Intronic
1041749182 8:61240273-61240295 AGTTGAGCACAGAGAGCACGGGG - Intronic
1042380918 8:68113333-68113355 ACATAAGCACAGAGGCCTCTTGG + Intronic
1043164187 8:76882766-76882788 ATTAAGAGACAGAGAGCTCTGGG - Intergenic
1044498745 8:92926236-92926258 ATTTAAGTACAGAGACATCATGG - Intronic
1046020834 8:108662742-108662764 ATTTATGCATAAAAAGCTCTGGG + Intronic
1047994472 8:130320599-130320621 ATTTAAACACTGAGAAGTCTAGG + Intronic
1049056983 8:140244620-140244642 GTTTGAGCACAGGGAGCTGTCGG - Intronic
1051062805 9:13064668-13064690 ATTTAAGTACAGAGGACTCAGGG - Intergenic
1051378233 9:16427124-16427146 ATTTAACAACAGTGAGCCCTTGG + Intronic
1052263574 9:26546067-26546089 AGTTAAATACAGAGAGATCTTGG + Intergenic
1056388586 9:86119573-86119595 GTTTGAGTACAGTGAGCTCTGGG + Intergenic
1056907866 9:90669623-90669645 CTTTTAGCACAGAGTGGTCTTGG - Intergenic
1057962721 9:99471940-99471962 ACTGAAGCACAGAGAGGTCAGGG + Intergenic
1059433370 9:114262853-114262875 ATTGAAGCATAGGGAGCTCCAGG + Intronic
1060972021 9:127743763-127743785 ACTGAAGCACAGAGAGAACTGGG + Intronic
1061241914 9:129379294-129379316 ACAGAAGCACAGAGAGCTCTGGG - Intergenic
1062086103 9:134649398-134649420 ATTTAATTACTCAGAGCTCTGGG + Intronic
1185569132 X:1119655-1119677 ATTTATCCACAGAGACTTCTTGG + Intergenic
1189235542 X:39484241-39484263 AGTTAGGCACAGAGAAATCTTGG - Intergenic
1190916848 X:54817457-54817479 GTCACAGCACAGAGAGCTCTGGG + Intergenic
1193444329 X:81581227-81581249 ATTTATGTACATAGAGCTGTTGG - Intergenic
1197484429 X:127030180-127030202 GTTTAAACACAGACAGCTTTGGG + Intergenic
1198665649 X:139019327-139019349 ATTCAGACACAGAGAGCTCCTGG + Intronic