ID: 1006510260

View in Genome Browser
Species Human (GRCh38)
Location 6:34517550-34517572
Sequence CTGCCAGGCTTGAGGAGCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 315}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006510260_1006510269 7 Left 1006510260 6:34517550-34517572 CCCTTGCTCCTCAAGCCTGGCAG 0: 1
1: 0
2: 0
3: 25
4: 315
Right 1006510269 6:34517580-34517602 CTGCCCCAGGGCCTTTGCATGGG 0: 12
1: 43
2: 141
3: 289
4: 626
1006510260_1006510268 6 Left 1006510260 6:34517550-34517572 CCCTTGCTCCTCAAGCCTGGCAG 0: 1
1: 0
2: 0
3: 25
4: 315
Right 1006510268 6:34517579-34517601 TCTGCCCCAGGGCCTTTGCATGG 0: 9
1: 19
2: 61
3: 659
4: 1436
1006510260_1006510265 -6 Left 1006510260 6:34517550-34517572 CCCTTGCTCCTCAAGCCTGGCAG 0: 1
1: 0
2: 0
3: 25
4: 315
Right 1006510265 6:34517567-34517589 TGGCAGCCGGCTTCTGCCCCAGG No data
1006510260_1006510266 -5 Left 1006510260 6:34517550-34517572 CCCTTGCTCCTCAAGCCTGGCAG 0: 1
1: 0
2: 0
3: 25
4: 315
Right 1006510266 6:34517568-34517590 GGCAGCCGGCTTCTGCCCCAGGG 0: 1
1: 0
2: 2
3: 17
4: 194
1006510260_1006510273 16 Left 1006510260 6:34517550-34517572 CCCTTGCTCCTCAAGCCTGGCAG 0: 1
1: 0
2: 0
3: 25
4: 315
Right 1006510273 6:34517589-34517611 GGCCTTTGCATGGGCTGTTCAGG 0: 1
1: 0
2: 2
3: 11
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006510260 Original CRISPR CTGCCAGGCTTGAGGAGCAA GGG (reversed) Intronic
900397727 1:2460107-2460129 AGGCCAGGCTAGAGCAGCAAGGG - Intronic
900519500 1:3098772-3098794 CTGCAGGGCTGGAGCAGCAAGGG - Intronic
901727918 1:11256887-11256909 CAGCCAGGCTTGGGGAACGATGG - Intronic
902376991 1:16034589-16034611 CTCCCAGGGGTGAGGAGCAGGGG + Intergenic
902382163 1:16057848-16057870 CTCCCAGGGGTGAGGAGCAGGGG + Exonic
903856730 1:26342277-26342299 CAGCCTGGCTTGAGGAGTCAGGG - Intronic
905291398 1:36924113-36924135 CTGCCAGGGCAGAGGATCAAGGG + Intronic
905678472 1:39847690-39847712 CTGCTAGCTTTTAGGAGCAATGG - Intronic
906120071 1:43383652-43383674 CTGCCAGGCTGTGGCAGCAAAGG - Intergenic
906882954 1:49612735-49612757 CTGCCAAGGTTGTGGAGAAAAGG + Intronic
907666234 1:56435977-56435999 TTGCCAGGCTGGAGGAGGAGGGG - Intergenic
907967999 1:59352167-59352189 CTGTCAGGCTTGAGCAGCTGGGG + Intronic
909304976 1:74062411-74062433 CTGCCAAGGTTGTGGAGGAAAGG + Intronic
909775651 1:79481588-79481610 CTGGCAAGGTTGTGGAGCAAAGG + Intergenic
910253216 1:85220019-85220041 CTGCCTGGCTGAAGGAGCAGTGG + Intergenic
910412951 1:86965522-86965544 CAGCCAGGCTTGAGAACCACTGG - Intronic
911900432 1:103496522-103496544 CTGCCAAGGTTGTGGAGAAAAGG + Intergenic
914033017 1:143975404-143975426 CTGCCCGGCTTGGGGGGAAAGGG - Intergenic
914156428 1:145092562-145092584 CTGCCCGGCTTGGGGGGAAAGGG + Intronic
916238264 1:162612618-162612640 CTATCAGAATTGAGGAGCAATGG + Intergenic
917353304 1:174101142-174101164 TTGCCAGGCTGGAGGTGCAGTGG + Intergenic
917427284 1:174928082-174928104 CTGCAAGGCTGGAGAAGGAAGGG - Intronic
918083031 1:181221983-181222005 CTGCCAGGCTTGGGCCTCAAAGG - Intergenic
918633196 1:186743917-186743939 TTGACAGGCTTGAGAAGCACTGG - Intergenic
921949210 1:220911407-220911429 CTGCCACACCTGAGGACCAATGG - Intergenic
921988560 1:221339221-221339243 CAGCCAGGCATGATGAGCACAGG + Intergenic
922228944 1:223668871-223668893 CTGCCAGCCTCGATGAGGAAGGG - Intergenic
923202534 1:231725996-231726018 CTGCAAGGCTGGAGGAGGAAAGG - Intronic
1062786388 10:268831-268853 CTGCCAGACTTGGGGAGCTGTGG + Intergenic
1063368041 10:5503088-5503110 CTGCCACCCTGGAGGAGAAAGGG + Intergenic
1065717504 10:28586646-28586668 CGGCCAGGCTGGAGGTGCAGTGG - Intronic
1067564321 10:47325878-47325900 ATGCCAGCCTGGAGGAGGAAAGG + Exonic
1067683316 10:48453563-48453585 CTGCCAGGCTCGATGAGGGAAGG + Intronic
1069526060 10:69173221-69173243 CAGCCAGGGTTGAGAACCAATGG - Intergenic
1069737959 10:70669974-70669996 CTCCCAGGCAGGAGGAGAAAAGG - Intergenic
1069873592 10:71547999-71548021 CAGGCAGGCTGGAGGAGCAGCGG - Intronic
1071795376 10:88999111-88999133 TTGCCAGGCTGGAGGTGCAGTGG - Intronic
1072501624 10:96023745-96023767 CTGCCATGGTGGAGGAGCACTGG - Intronic
1075060454 10:119253380-119253402 CTGCCAGGCCTGTGGAGAAGAGG + Intronic
1076671566 10:132123722-132123744 GAGCCAGGCTTGGGGTGCAAAGG - Intronic
1077408753 11:2393952-2393974 CTGCCAGGGATGAGCAGCAAGGG - Intronic
1078863528 11:15275589-15275611 TTGCCAGACATGAGGATCAATGG - Intergenic
1079107077 11:17578550-17578572 CTGCCAGCCTTCAGGATCACGGG - Intronic
1080887309 11:36378010-36378032 CTCCCGGGCTTGATCAGCAAGGG - Intronic
1081893496 11:46565216-46565238 CTCCCAGGCTTGGAGTGCAATGG - Intronic
1083281688 11:61630571-61630593 CAGCCAGGCTTGGGGACCACTGG - Intergenic
1084669075 11:70594848-70594870 CTGCAGGGCTGGAGGAGCATGGG - Intronic
1085430646 11:76445171-76445193 CAGCCAGGCTAGAGGAGCGCCGG + Intronic
1086451738 11:86924020-86924042 CTACCAAGCTTGAGAAGCACCGG - Intronic
1087817360 11:102674321-102674343 CTGCTATGCTTGAGGTGCCAAGG + Intergenic
1088735491 11:112724677-112724699 TAGCCAGGCTTGTGGGGCAAGGG + Intergenic
1090217563 11:124983642-124983664 CTGCCACACTGGAGGAGCTAAGG + Intronic
1090586484 11:128218835-128218857 CTACCTGGCTTGAGGGGCACAGG - Intergenic
1090990323 11:131811430-131811452 CAGGCAGGCTTGAGGAGCTTGGG + Intronic
1091042257 11:132292675-132292697 TTGCCAGGCTAGTGGAACAAGGG + Intronic
1093979449 12:25459708-25459730 CGCCCAGGCCTGAGGGGCAATGG - Intronic
1094262229 12:28514095-28514117 CTGGCAAGGTTGAGGAGAAAAGG - Intronic
1095862127 12:46929191-46929213 CAGCCAGGATTGAGAAGCACTGG + Intergenic
1096994662 12:55831057-55831079 CTGCCAGGATTGAGGAGAGGAGG - Intergenic
1097070518 12:56351119-56351141 CTGCCAGTCTTGAGGATGAGGGG + Exonic
1097218767 12:57434549-57434571 CTGCCAGGCCTGGGGTTCAAAGG - Intergenic
1098311934 12:69157191-69157213 CTGCAAGGCTGGAGGAGGGAAGG - Intergenic
1098382616 12:69884577-69884599 CTGCCACGCTTGAGTGGGAAAGG + Intronic
1098491593 12:71087268-71087290 CTGGCAAGCTTGTGGAGAAAAGG - Intronic
1099078866 12:78149591-78149613 TTCCCAGTCCTGAGGAGCAATGG + Intronic
1099300753 12:80891610-80891632 CTCACAGGCTTGAGGGGCAGGGG + Intronic
1101551981 12:105771741-105771763 CAGCCAGGCTTGGGGAGGATGGG + Intergenic
1103704133 12:122862314-122862336 GGGCCAGGCCTGAGGAGTAATGG - Exonic
1104126929 12:125856488-125856510 CAGCCAGGCTAGAGAGGCAAAGG - Intergenic
1104598910 12:130139335-130139357 TTGCCAGGGTTGTAGAGCAATGG + Intergenic
1104654995 12:130567767-130567789 CTGCAAGGCTGGAGGACCAGGGG - Intronic
1105441932 13:20422513-20422535 CAGCCTGGCTGGAGGTGCAAGGG - Intronic
1105443468 13:20434079-20434101 CTGCCAGGGTTGGGGACCATGGG - Intronic
1105809132 13:23979403-23979425 TTCCCAGGCTTGAGGATCAGCGG - Intergenic
1106387303 13:29300380-29300402 TTGTCAGCCTTGAGGAGCTATGG + Intronic
1106652970 13:31711695-31711717 CTGCTACTCATGAGGAGCAATGG - Intergenic
1107525939 13:41231291-41231313 AAGTCAGGCTTGAGGAGCTAGGG + Intronic
1107905093 13:45054311-45054333 CTGCTGGACTTAAGGAGCAAAGG + Intergenic
1108243197 13:48488377-48488399 CTGCCAGGAGTTAGGGGCAAAGG + Intergenic
1109022397 13:57114780-57114802 CTGACAGGGTTGTGGAGAAAAGG - Intergenic
1109055174 13:57537938-57537960 CTGCCAAGCTATAAGAGCAATGG - Intergenic
1109105570 13:58245859-58245881 CTGGCAAGGTTGAGGAGAAAAGG + Intergenic
1109714590 13:66204746-66204768 CTGTCAGGGTTGAGGGGCAAGGG + Intergenic
1109756103 13:66762212-66762234 CTGGCAGGCTTTAGCAGCCATGG - Intronic
1112032553 13:95470993-95471015 CTTCCAGGCTAGAGGGGGAAAGG + Intronic
1112482014 13:99784929-99784951 CGCCCAGGCTTGGGGTGCAATGG + Intronic
1112524393 13:100130294-100130316 CTGCCAAGTTGGAGTAGCAAAGG + Intronic
1113247634 13:108416179-108416201 CTGGCAAGATTGAGGAGAAATGG - Intergenic
1113598039 13:111548122-111548144 CTGCCCGGCTTGTGGAGCCCGGG + Intergenic
1114547230 14:23512078-23512100 CTGCCAGGCTGGGGGTGCAGAGG - Intergenic
1118016755 14:61668590-61668612 AGTCCAGGCTTGAAGAGCAAGGG - Intergenic
1120410206 14:84144836-84144858 CTGTCAGGGGTGGGGAGCAAGGG - Intergenic
1121567482 14:94921555-94921577 CAGCCAGGCTTGAGAACCACTGG - Intergenic
1124830953 15:33148685-33148707 CTGCAAGGCTGAAGGCGCAAGGG - Intronic
1125382875 15:39105696-39105718 CTGGCAAGGTTGAGGAGAAAAGG - Intergenic
1125716560 15:41822948-41822970 GTGCCAGGCTTGAGGAGGATGGG - Exonic
1126300194 15:47185641-47185663 CGGCCAGGGTGGGGGAGCAATGG - Intronic
1128381554 15:67116878-67116900 ATGCCAGGTTTGAAGAGCAAAGG + Intronic
1129669885 15:77601676-77601698 CAGCCAGGATTGAGGACCACTGG + Intergenic
1130057127 15:80536270-80536292 TAGACAGGCTTGAGGAGCCAGGG + Intronic
1130994582 15:88896804-88896826 ACGCCAGGCTTGATGGGCAAAGG + Intergenic
1131955999 15:97736798-97736820 CTCCCAGCCATGAGGAGGAAGGG + Intergenic
1133526410 16:6609966-6609988 CTGCCAGGCCTGGAGTGCAATGG - Intronic
1135237138 16:20767672-20767694 TTGGCAGGCTTTAGGAGAAAAGG - Intronic
1135588715 16:23690450-23690472 CTGCCAGTCTTGTGGGGGAAAGG + Exonic
1137364747 16:47851196-47851218 CTGCCAGGGCTGAAGAGCACAGG + Intergenic
1137365075 16:47853319-47853341 CAGCTAGCCTTGAGGAGTAAAGG - Intergenic
1138429284 16:56958109-56958131 TTGACAGGTTTGAGGAGCAGTGG - Intergenic
1139106824 16:63835984-63836006 CTGCTATGCTAGAGGAGCCAAGG - Intergenic
1140153052 16:72391740-72391762 CAGCCAGGGTTAAGGACCAAAGG + Intergenic
1140374219 16:74431819-74431841 CTGCCAGCCTTGCAGAGCAAAGG + Intergenic
1140767073 16:78169838-78169860 CTGGCAGGCATGAGGAACATTGG - Intronic
1141545655 16:84766476-84766498 CTGCTGGGCTGAAGGAGCAAAGG - Intronic
1142351720 16:89583724-89583746 CTGCCAAACTTGAGCAGCAGCGG - Exonic
1142355598 16:89600159-89600181 CTTCCTGGCTTGAGGAGCTGTGG + Intergenic
1143155995 17:4836420-4836442 CAGCCAGGCTGGTGGAGAAAAGG - Intronic
1144707101 17:17376949-17376971 TTGCCTGCCTTGAGGAGCAAGGG + Intergenic
1144845833 17:18218524-18218546 CTGTCAGGATTGAGGCCCAAGGG - Intergenic
1144955525 17:19017103-19017125 CTGCCAGGCTTGCAGGGCTAGGG - Intronic
1146207871 17:30920520-30920542 CTGCCAGGACTGAGCAGGAAGGG - Intronic
1147322996 17:39657230-39657252 CGCCCAGCCTTGTGGAGCAAAGG - Intronic
1147741570 17:42673491-42673513 CTGCCTGGCGTGGGGAGCAGAGG + Exonic
1148734693 17:49858824-49858846 CTGCCAGGGTTGAAGATCAGAGG + Intergenic
1149087271 17:52733114-52733136 ATGCCACGTTTCAGGAGCAATGG - Intergenic
1150629738 17:66870938-66870960 CATCCAGGCTGGAGGTGCAATGG - Intronic
1150652053 17:67016684-67016706 CTCCCAGGCTGCAGGAGCAGGGG + Intronic
1151227583 17:72658311-72658333 CTACCAGGTTGGAAGAGCAAAGG - Intronic
1151370805 17:73645097-73645119 CTCCCGGGCCGGAGGAGCAACGG + Intergenic
1152096704 17:78276810-78276832 CTGCCAGGATTGATGGGCTAAGG + Intergenic
1153805858 18:8707303-8707325 TGGCCCGGGTTGAGGAGCAACGG + Intronic
1155284343 18:24272500-24272522 CAGCCAGGCTTGAAGGGCAAAGG + Intronic
1155515189 18:26617407-26617429 ATGCCGTGTTTGAGGAGCAAAGG + Intronic
1159320836 18:66846015-66846037 TTGCCAGGCTGGAGGTGCAGTGG + Intergenic
1160252858 18:77218849-77218871 CTGCCAGGCTTTGGGAGGAAGGG - Intergenic
1160831542 19:1106859-1106881 CTGCCAGGCTGGGGGTGCCATGG + Intergenic
1162830623 19:13282167-13282189 CTGCCAGGCCTGGGAAGGAAGGG + Intronic
1163758228 19:19119669-19119691 GTGCCAGGTTTGAGTGGCAAGGG - Exonic
1164436850 19:28237784-28237806 CTGCCTTGCTTAAGGAGGAAAGG + Intergenic
1164715833 19:30389701-30389723 CTGCTAGGATTCAGGAGCCAAGG - Intronic
1165310754 19:35028276-35028298 CTGCCAGGCAAGAGGAGCCAGGG - Intergenic
1165680449 19:37769886-37769908 CACCCAGACTTGTGGAGCAAAGG - Intronic
1165721051 19:38080021-38080043 CTGCGGGGCTTGTGGAGCAGGGG + Intronic
1167892902 19:52556716-52556738 CTCCCAGGCTGGAGTTGCAATGG - Intronic
1168642408 19:58038941-58038963 CAGCCACGCTGCAGGAGCAAAGG + Intronic
925104756 2:1281899-1281921 CTCCCGGGCTTGAGGAGACACGG - Intronic
925943515 2:8840538-8840560 CTGGCAAGCTTGTGGAGAAATGG - Intergenic
926812974 2:16772801-16772823 CTGCCATGTTTGTGGAGCAGAGG - Intergenic
927111897 2:19869449-19869471 CTGCCAGCCTGGAGGAGCCTGGG - Intergenic
927147913 2:20179060-20179082 CTGCCAGGCTTGCAGATCAAAGG - Intergenic
927518404 2:23685401-23685423 CTGCAAGGCAAGAGGAGCAGCGG - Intronic
929874961 2:45788893-45788915 CAGCCAGAGTTGAGGACCAATGG - Intronic
931070550 2:58643727-58643749 CAGCCAGGTTTGAGAAGCACAGG + Intergenic
931927632 2:67091469-67091491 CTGCCAGGGATGTGGAGTAAAGG + Intergenic
932294978 2:70616631-70616653 CTGCCCTGCTTGGGGAGCAGTGG - Intronic
934568681 2:95354580-95354602 CTCCCAGGATGGAGGAGCAAGGG - Intronic
935524001 2:104143560-104143582 CTGCCAGTCTTGTGGAACATGGG - Intergenic
936282995 2:111159107-111159129 CTTTCAGGTCTGAGGAGCAACGG + Intronic
936347500 2:111686471-111686493 CTTTCAGGTTTGAGGAGCATTGG + Intergenic
938699442 2:133863112-133863134 CTTCCAGTCTTGAGGAAGAAAGG - Intergenic
942401092 2:175604241-175604263 CTGTCAGGGGTGGGGAGCAAGGG + Intergenic
943688990 2:190849790-190849812 CTGCCTGTCTTGATGACCAAGGG + Intergenic
946107234 2:217381793-217381815 CTGTAAGGCTTGAGTTGCAAGGG + Intronic
948654075 2:239465949-239465971 CTGCCAGGCATCAGGAGCCACGG + Intergenic
1168793539 20:596084-596106 CAGCCAGGGCTGAGAAGCAATGG - Intergenic
1169188238 20:3638279-3638301 CTGTCAGGGGTGGGGAGCAAGGG - Intronic
1169703630 20:8477344-8477366 CTGCCAGGTATTAGGACCAAAGG + Intronic
1171522025 20:25783455-25783477 CTGCAAGGCCTGAGGAAGAATGG - Intronic
1171554800 20:26072428-26072450 CTGCAAGGCCTGAGGAAGAATGG + Intergenic
1172788309 20:37485048-37485070 TTTCCAGGTATGAGGAGCAATGG + Intergenic
1173182681 20:40816518-40816540 CTGCCAGACTGAAGGGGCAAGGG - Intergenic
1174439584 20:50539743-50539765 CTCCTGGGCTTGAGGAACAAAGG + Intronic
1174767206 20:53265487-53265509 CTGCGGGGCTGGAGGAGGAAAGG - Intronic
1175288500 20:57855621-57855643 ATGCCAACCCTGAGGAGCAAAGG - Intergenic
1175803096 20:61812278-61812300 CTGCCAGAGCTGAGGAGCACAGG + Intronic
1175819329 20:61900157-61900179 CAGCCAGGCTTGAGGGGCTGGGG - Intronic
1175904214 20:62371806-62371828 CTGCCAGCCTTTAGGAGGGAAGG + Intergenic
1177332312 21:19680088-19680110 GTGCCAGGATTCAGGAGCAAAGG + Intergenic
1178322375 21:31615170-31615192 CTGCCAGGCTTCAGAGGCCAGGG - Intergenic
1178777583 21:35566960-35566982 CTGCAAGGGTTGAGGGGTAAGGG - Intronic
1178796924 21:35753420-35753442 GAGCCAGTCTTGAAGAGCAAGGG + Intronic
1179429586 21:41310765-41310787 CAGCCAGGCTTGCTGAGCCAGGG - Intronic
1181172049 22:21015357-21015379 TGGCCAGGCTGGAGGGGCAAGGG + Intronic
1181177257 22:21044843-21044865 TGGCCAGGCTGGAGGGGCAAGGG - Intergenic
1181873657 22:25923064-25923086 CTGACAGTTTTGAGGAGCACTGG + Intronic
1182020742 22:27079740-27079762 CTGCCAGGCTAGGAGTGCAATGG + Intergenic
1182241237 22:28918005-28918027 CTCCCAGGCTAGAGGTTCAAAGG - Intronic
1182361549 22:29749425-29749447 CTGGCATGTGTGAGGAGCAAAGG - Intronic
1183453227 22:37907576-37907598 CTGCCAGGCTGGGGGAGCCCTGG - Intronic
949834382 3:8252226-8252248 CTGCCAAGGTTGTGGAGAAAAGG - Intergenic
950167693 3:10814187-10814209 CACCCAGGCTGGAGGTGCAATGG - Intergenic
951032366 3:17896261-17896283 CTGCCAGGCTTGGGAAGGGATGG + Intronic
951454219 3:22872542-22872564 CTGGCAGGCGTCAGGATCAAGGG + Intergenic
952808813 3:37383229-37383251 CTGGCAAGGTTGCGGAGCAAAGG + Intergenic
954363658 3:50135172-50135194 CTGGCAGGCTTGTGCAGCACTGG + Intergenic
954486374 3:50856318-50856340 CTGGCAAGGTTGAGGAGAAAAGG - Intronic
956753449 3:72363237-72363259 GTGCCAGGCCTGAAGGGCAAGGG - Intergenic
957164028 3:76647328-76647350 CTGAAAGGCTAGAGGAGGAAGGG - Intronic
957846592 3:85744702-85744724 TTGCCATGCTTAAGGAGCAAGGG + Intronic
958802899 3:98777131-98777153 CTGCCAGCCAGGAGGAGGAAAGG + Intronic
959463389 3:106654163-106654185 CTGGCAAGGTTGAGGAGAAAAGG + Intergenic
961110968 3:124282736-124282758 CTGGCAGCCTTGAGGAGTGATGG + Intronic
961433776 3:126902275-126902297 CGGCCAGGGTTGAGGACCACTGG + Intronic
961944621 3:130672969-130672991 TTGCCAGGCTGGAGGTGCAGTGG - Intronic
965676711 3:171205413-171205435 CTGCCAGGTTTGAAGGACAAAGG - Intronic
966795000 3:183705086-183705108 CACCCAGGCTGGAGGTGCAACGG + Intronic
967186872 3:186951424-186951446 CAGCCAGGGTTGAGAACCAATGG - Intronic
967723774 3:192842657-192842679 CTGACAGGTCTGAGGAGGAAAGG + Intronic
968019285 3:195369896-195369918 CTGCCAAGGTTGTGGAGAAAAGG - Intronic
968481072 4:833353-833375 CTGCCAGGCCTGTGGAGCTGTGG - Intergenic
968703735 4:2068849-2068871 AGGCCAGGCTTGGGGAGCACAGG + Exonic
971199418 4:24498515-24498537 TTGACAGGTTTGGGGAGCAAAGG - Intergenic
971262864 4:25072956-25072978 CTGCCTGACTTGAGGACCAGAGG + Intergenic
973196740 4:47452954-47452976 CACCCAGGCTGGAGGGGCAACGG - Intronic
974696597 4:65383679-65383701 CTGCCAGTCTGAAGGAGTAATGG + Intronic
975569886 4:75804497-75804519 CAGCCAGGGTTGAGAATCAATGG - Intronic
977972902 4:103231828-103231850 TTGGCAAGCTTGAGGAGAAAAGG + Intergenic
978112840 4:104983859-104983881 CTGACAGGGTTGTGGAGAAAAGG + Intergenic
978290222 4:107129138-107129160 TTGCCAGAGTTGAGGAGCACTGG - Intronic
978348813 4:107799930-107799952 CTGCCCCTCTTGAGGAGCAAAGG - Intergenic
979631058 4:122903678-122903700 CTGCAAGGCTGGAGGAGGAAGGG + Intronic
980454407 4:133020456-133020478 CTGTCAGGGTTGGGGGGCAAGGG + Intergenic
980464366 4:133153022-133153044 CTGACAGGATGGAAGAGCAAAGG - Intronic
980981560 4:139658618-139658640 GTGCCAGGATAGAGGAGAAAGGG - Intergenic
981073460 4:140568796-140568818 CGGACAGGCGTGAAGAGCAAGGG - Exonic
981388457 4:144159021-144159043 CTGGCAAGGTTGCGGAGCAAAGG - Intergenic
984633950 4:182091326-182091348 CTGCCAGGAATGAGTTGCAAGGG + Intergenic
984672802 4:182511071-182511093 CTGCCAGAGTTGGGGAACAAAGG + Intronic
985156352 4:186991966-186991988 CTGCCAAGGTTGTGGAGAAAAGG + Intergenic
985997515 5:3605167-3605189 CTGCAAGGCTGGGGGAGCATTGG + Intergenic
989509156 5:42263990-42264012 CTGTCAGGGTTGGGGAGCTAGGG - Intergenic
990291081 5:54352624-54352646 CTGACAGGGTTGTGGAGAAAAGG - Intergenic
990348668 5:54893938-54893960 CTGGCAAGGTTGAGGAGAAAAGG + Intergenic
990415641 5:55583910-55583932 CTCCCAGGCTGGAGTAGCAGTGG + Intergenic
990678078 5:58211124-58211146 CTGACATGCTTTAGGATCAAAGG + Intergenic
990696856 5:58427533-58427555 TGGCCAGGGTTGAGGGGCAATGG + Intergenic
991419326 5:66425628-66425650 GTGACAGGCTTGGGGACCAAAGG - Intergenic
991495446 5:67221439-67221461 CTGGCACACTTGAGGAGCTAAGG - Intergenic
992473821 5:77083175-77083197 CTCACATGCTTGAGGAGCCAAGG - Intronic
993146764 5:84103724-84103746 CTGGCAAGGTTGAGGAGAAAAGG + Intronic
998068862 5:139180879-139180901 CTGCCTAGCTAGAGGAGCTATGG - Intronic
998097869 5:139407200-139407222 CTGCTAGGGCTGAGGACCAAAGG + Intergenic
998423461 5:142007929-142007951 CTTCCAGACTTGGGGTGCAAGGG - Intronic
998704732 5:144745649-144745671 CTGTCAGGAGTGAGGGGCAAGGG - Intergenic
998952494 5:147406051-147406073 CTGAGAAGATTGAGGAGCAAAGG - Intronic
1000095236 5:157966003-157966025 CTGCCTGGCTCGAAGAGCCAGGG - Intergenic
1001699284 5:173695257-173695279 GAGCCAGGCTTGAGAACCAAAGG - Intergenic
1001770904 5:174295130-174295152 CTGCCAGGCTGGAGGCTCAGGGG + Intergenic
1001988714 5:176098017-176098039 TTGCCAGGCTTGATCACCAAAGG + Intronic
1002228154 5:177740119-177740141 TTGCCAGGCTTGATCACCAAAGG - Intronic
1002311883 5:178319933-178319955 CTGGCAGGCCTGAGGAGTGACGG - Intronic
1003291194 6:4779658-4779680 CTGCTAGGATTGAGGAAAAACGG + Intronic
1003364391 6:5458367-5458389 CTGCCAGGGCTGAGGAGCACTGG + Intronic
1003567988 6:7236576-7236598 CTGCAGGGGTGGAGGAGCAATGG + Intronic
1004566741 6:16805063-16805085 CAGCCAAGCTTGAGGATCAGAGG - Intergenic
1004901267 6:20196424-20196446 TTGCCAGGATTGAGGAAGAAGGG + Intronic
1005380519 6:25229551-25229573 CTGAAAGGTTTCAGGAGCAATGG + Intergenic
1005465145 6:26105385-26105407 ATACAAGGCTAGAGGAGCAAAGG + Intergenic
1006510260 6:34517550-34517572 CTGCCAGGCTTGAGGAGCAAGGG - Intronic
1006774576 6:36582177-36582199 CTGCAAGCTTTGAGGGGCAATGG + Intergenic
1006986641 6:38179949-38179971 CTGCCAGGAGTGAGGTGCCAAGG - Intronic
1007718345 6:43870193-43870215 CTCCCAGGCCTGAAGGGCAAAGG + Intergenic
1008642521 6:53479150-53479172 CTGCCAAGGTTGTGGAGAAAAGG - Intergenic
1008744473 6:54652427-54652449 CACCCAGGCTGGAGGTGCAATGG - Intergenic
1009392334 6:63159744-63159766 CGCCCAGGCTGGAGGTGCAATGG + Intergenic
1010078073 6:71824589-71824611 CCCCCAGGCTGGAGGTGCAATGG - Intergenic
1010195455 6:73235345-73235367 CTGCCGGGGGTGATGAGCAAGGG - Intronic
1011144228 6:84194491-84194513 TTGCCAGGCTGGAGGAGCAGTGG + Intronic
1011398834 6:86937911-86937933 TTGCCAGCTTTGAGGCGCAAAGG + Intronic
1011746937 6:90415250-90415272 CGGCCAGGGTGGAGGAGGAAGGG - Intergenic
1012620745 6:101340568-101340590 CTACCAGGGTTGAGGAGGAGTGG + Intergenic
1012827383 6:104163118-104163140 CTGCCATGCTTGAGTAGCACTGG - Intergenic
1016040762 6:139429804-139429826 CTGCCAGGCCTGAGGCTGAAAGG + Intergenic
1017705381 6:157117936-157117958 GTGCCAGGCTCCAGGTGCAAGGG - Intronic
1020651398 7:10880966-10880988 CTGCCCAGCTGGAGCAGCAAGGG - Intergenic
1022852010 7:34273409-34273431 CTTCAAGGCTTGAGGAGAAGAGG + Intergenic
1023841439 7:44100761-44100783 CAGCCAGGCCTGAGAAGCACCGG + Intergenic
1024156420 7:46630123-46630145 CTCCCAGGCCTGAGTAGAAATGG + Intergenic
1029536678 7:101161344-101161366 CTGCCAGCCTTGGGAAGAAACGG + Intronic
1031327396 7:120418657-120418679 CAGCCAGGCTTGAGAATCACTGG + Intronic
1031455869 7:121978963-121978985 CTGGCAACCTTGAGGATCAAAGG + Intronic
1032121389 7:129159724-129159746 CTGCCAGGCTCACGGAGCATGGG - Intronic
1033047550 7:137976401-137976423 CAGCCAGGTTTGAGGATCACTGG - Intronic
1035027727 7:155836806-155836828 CTGCCAGGCTTGATGCCCACTGG + Intergenic
1035569117 8:660399-660421 CTGCCAGGTTGGAGGGGCCACGG + Intronic
1035747121 8:1970267-1970289 CTGTCAGGGATGATGAGCAATGG + Intergenic
1036727146 8:11230404-11230426 CTTCCAGGGGTGAGGAGCCAAGG + Intergenic
1036793578 8:11739922-11739944 CTGCGAGGGTCCAGGAGCAAGGG - Intronic
1037671417 8:21018363-21018385 CTGCCAGTGTTAAAGAGCAAAGG - Intergenic
1038018062 8:23531228-23531250 CTGCCAAGCATGAGGAGTCAGGG + Intronic
1038827038 8:31015147-31015169 TTGCCAGGCTTGCGGGGGAAAGG + Intronic
1038923629 8:32113473-32113495 CTGTCAGGCTGGAGGAACCAAGG - Intronic
1039249748 8:35649793-35649815 TTGGCAGGCTTGAGGAGCACTGG - Intronic
1039786357 8:40837919-40837941 GTGCCAGGGGTGAGGAGCATGGG - Intronic
1041132868 8:54721433-54721455 CTGCCATGCTGGAAGAGCACAGG + Intergenic
1041307956 8:56483063-56483085 CACCCAGGCTGGAGGTGCAATGG - Intergenic
1042065368 8:64869167-64869189 CTGCGAGGATTGAGTTGCAAAGG - Intergenic
1042606638 8:70552887-70552909 CTGCCAGGCAGTAGGAGGAAAGG + Intergenic
1044769214 8:95611816-95611838 CTGGCAAGGTTGAGGAGAAAAGG - Intergenic
1045024624 8:98074992-98075014 CTGACAGTTTTGAGGAGCACTGG + Intronic
1046634401 8:116657357-116657379 CTGCCAGGCTTGAATGGCATTGG + Intronic
1047104670 8:121719863-121719885 CTGCCAGTCCTGTGGAACAAAGG - Intergenic
1047462810 8:125084809-125084831 CAGCCAGGCTTGAGAACCACTGG - Intronic
1049104266 8:140601570-140601592 CTGCCATGGTTGCGGAGCAAAGG - Intronic
1049592665 8:143469653-143469675 CTGCCAGGCCTGAGAGCCAAGGG + Intronic
1049864397 8:144924590-144924612 CTGCCAGGCATGAGGCGCCAAGG - Intergenic
1050315881 9:4400327-4400349 CAGGCAGGCTAGAGAAGCAAAGG + Intergenic
1050336836 9:4597658-4597680 CTCCCAGGCCAAAGGAGCAAAGG + Intronic
1051608964 9:18943045-18943067 CAGCCATGCTTGACTAGCAAAGG + Intronic
1053148447 9:35727796-35727818 CTTCCGTGCTTGAGGAGGAAGGG - Intronic
1055760386 9:79600736-79600758 GAGCCAGGCTTGGGGAGCCATGG - Intronic
1056519089 9:87383571-87383593 CTGAGAGTCTTGAGGAGCAGAGG - Intergenic
1058199604 9:102022856-102022878 CTGGCAGGGTTGTGGAGAAAAGG - Intergenic
1058898567 9:109421386-109421408 CTGACAGTCCTGAGGAGAAATGG - Intronic
1059578188 9:115514563-115514585 GTGCCAGGGTTGGGGAACAAAGG + Intergenic
1061169462 9:128943850-128943872 CTCCCAAGCTTGGGGAGAAAGGG + Intronic
1062059276 9:134486277-134486299 CTCCCTGGCTTGCGGGGCAAAGG - Intergenic
1062192553 9:135255356-135255378 CGGCCAGGCTAGAGCAGAAAGGG + Intergenic
1062431787 9:136529631-136529653 CTGGCAGGTTTGAGGAGCCCGGG - Intronic
1062595933 9:137299236-137299258 CTGCCAGGAGTGAGCAGCTATGG + Intergenic
1185891605 X:3827180-3827202 CTGCCAGGGTTGGGGAAAAAGGG + Intronic
1185896716 X:3865595-3865617 CTGCCAGGGTTGGGGAAAAAGGG + Intergenic
1185901834 X:3904022-3904044 CTGCCAGGGTTGGGGAAAAAGGG + Intergenic
1185983613 X:4806562-4806584 CTGCAATGCCTGAGAAGCAAGGG + Intergenic
1186498639 X:10032599-10032621 CTTGCTGGCTTGAGGAGTAAAGG + Intronic
1188014332 X:25091224-25091246 CTGGCAAGGTTGAGGAGAAAAGG - Intergenic
1188985762 X:36767140-36767162 CAGCCAGGCTAGGGGAGAAAAGG - Intergenic
1190511070 X:51174981-51175003 CTGCCAGGGGTGGGGGGCAAGGG + Intergenic
1190515273 X:51217309-51217331 CTGCCATGGTTGTGGAGAAAAGG - Intergenic
1191831755 X:65422681-65422703 CTGTCAGGAGTGAGGGGCAAAGG - Intronic
1191842656 X:65524118-65524140 CTGCCAGCCTTGGGGATCAGCGG - Exonic
1192437434 X:71151633-71151655 GTGCCAGGCTGAAGGAGCAAAGG + Intronic
1192805216 X:74502800-74502822 CTGCCAGGTTTGAGAGGCAATGG - Intronic
1193522096 X:82542948-82542970 CTGGCAGCCTTGTGGAGAAAAGG + Intergenic
1193657357 X:84214561-84214583 CTACCAGGGATCAGGAGCAAAGG + Intergenic
1193826471 X:86232698-86232720 CTGGCAAGGTTGAGGAGAAAAGG + Intronic
1194867894 X:99091340-99091362 CTGTCAAGGTTGAGGAGAAAAGG + Intergenic
1195301197 X:103531364-103531386 CTGACAGTCTTGAGGAGTACAGG - Intergenic
1197595425 X:128458244-128458266 CTGACAGGCTTCAGGATCAGGGG + Intergenic
1199377332 X:147129043-147129065 CTGGCAGGATTGTGGAGAAAAGG - Intergenic
1199640853 X:149859320-149859342 CTGCCATGCTGGAGGAGAAGAGG - Intergenic
1200646414 Y:5789831-5789853 CTGACAAGGTTGTGGAGCAAAGG + Intergenic