ID: 1006510482

View in Genome Browser
Species Human (GRCh38)
Location 6:34518632-34518654
Sequence CCCTCCCAGAGCTCTCCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 455
Summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 397}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006510482_1006510492 17 Left 1006510482 6:34518632-34518654 CCCGCTGGAGAGCTCTGGGAGGG 0: 1
1: 0
2: 3
3: 54
4: 397
Right 1006510492 6:34518672-34518694 GACTCAGTCCAGGAGGGCAGGGG 0: 1
1: 0
2: 4
3: 31
4: 374
1006510482_1006510491 16 Left 1006510482 6:34518632-34518654 CCCGCTGGAGAGCTCTGGGAGGG 0: 1
1: 0
2: 3
3: 54
4: 397
Right 1006510491 6:34518671-34518693 TGACTCAGTCCAGGAGGGCAGGG 0: 1
1: 0
2: 0
3: 49
4: 725
1006510482_1006510490 15 Left 1006510482 6:34518632-34518654 CCCGCTGGAGAGCTCTGGGAGGG 0: 1
1: 0
2: 3
3: 54
4: 397
Right 1006510490 6:34518670-34518692 TTGACTCAGTCCAGGAGGGCAGG No data
1006510482_1006510494 24 Left 1006510482 6:34518632-34518654 CCCGCTGGAGAGCTCTGGGAGGG 0: 1
1: 0
2: 3
3: 54
4: 397
Right 1006510494 6:34518679-34518701 TCCAGGAGGGCAGGGGAGCTGGG 0: 1
1: 0
2: 6
3: 80
4: 601
1006510482_1006510496 25 Left 1006510482 6:34518632-34518654 CCCGCTGGAGAGCTCTGGGAGGG 0: 1
1: 0
2: 3
3: 54
4: 397
Right 1006510496 6:34518680-34518702 CCAGGAGGGCAGGGGAGCTGGGG No data
1006510482_1006510493 23 Left 1006510482 6:34518632-34518654 CCCGCTGGAGAGCTCTGGGAGGG 0: 1
1: 0
2: 3
3: 54
4: 397
Right 1006510493 6:34518678-34518700 GTCCAGGAGGGCAGGGGAGCTGG 0: 1
1: 0
2: 7
3: 94
4: 808
1006510482_1006510488 11 Left 1006510482 6:34518632-34518654 CCCGCTGGAGAGCTCTGGGAGGG 0: 1
1: 0
2: 3
3: 54
4: 397
Right 1006510488 6:34518666-34518688 ACCTTTGACTCAGTCCAGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 114
1006510482_1006510487 10 Left 1006510482 6:34518632-34518654 CCCGCTGGAGAGCTCTGGGAGGG 0: 1
1: 0
2: 3
3: 54
4: 397
Right 1006510487 6:34518665-34518687 CACCTTTGACTCAGTCCAGGAGG No data
1006510482_1006510486 7 Left 1006510482 6:34518632-34518654 CCCGCTGGAGAGCTCTGGGAGGG 0: 1
1: 0
2: 3
3: 54
4: 397
Right 1006510486 6:34518662-34518684 ACACACCTTTGACTCAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006510482 Original CRISPR CCCTCCCAGAGCTCTCCAGC GGG (reversed) Intronic
900106036 1:981521-981543 CCATCCCAGTGCGCCCCAGCTGG + Intronic
900548737 1:3243080-3243102 TCCTCCCAGGTCGCTCCAGCCGG - Intronic
900660237 1:3778424-3778446 CCCACCCAGATCTTGCCAGCAGG - Intergenic
901628579 1:10637476-10637498 CCTCCCCAGAGGTCTCCAGGAGG - Exonic
901643953 1:10706746-10706768 CCCTCCCAGAGCCCTGTATCTGG - Intronic
902035023 1:13451605-13451627 GCCTCCCAGAGGTCGGCAGCAGG - Intergenic
902681556 1:18047508-18047530 CGCTCCCAGAGCCTTCCTGCTGG + Intergenic
902785744 1:18731599-18731621 CCCTCCCGCCGCTCTCCAGTTGG + Intronic
902989738 1:20178435-20178457 CTCTCCCAGGGATCTGCAGCAGG - Intergenic
903237416 1:21959116-21959138 CCCTTCCTGACCTCTTCAGCTGG + Intergenic
903502303 1:23807839-23807861 TCCTCCCAGATCTCCTCAGCTGG + Intronic
904330615 1:29755779-29755801 CCCTCCCTGAGCCCCGCAGCTGG + Intergenic
904416059 1:30361816-30361838 CCCTCCCTGAGCCCCACAGCTGG - Intergenic
904858419 1:33517259-33517281 CCAGCCCACAGGTCTCCAGCAGG - Intronic
905449393 1:38046947-38046969 GCCGCCCAGAGCTCTCCATTGGG + Intergenic
905479722 1:38253175-38253197 CCCTCCCTGATTGCTCCAGCAGG - Intergenic
905599607 1:39238406-39238428 CCCTTCCTGAGCTCCCCAGAGGG + Intronic
905689679 1:39933752-39933774 GATTCCCAGAGCTCTCCAGAAGG - Intergenic
906790337 1:48653700-48653722 CCCTCCCAGTTCTCTACCGCAGG - Intronic
908010062 1:59766789-59766811 CCCTCCAAGAGCTCACAGGCCGG - Intronic
908332025 1:63080658-63080680 GCTTCCCAGAGTTCTCCAGAGGG - Intergenic
909691189 1:78409586-78409608 CCTTGCCAGTGCTTTCCAGCTGG + Intronic
911563623 1:99435981-99436003 CAGTCCCAGTGCTCCCCAGCTGG - Intergenic
911639661 1:100274234-100274256 CCCTCAAAGAGCTCACCATCTGG - Intronic
912499349 1:110111808-110111830 ACCTCCCAGAACTCCCCAGCAGG + Intergenic
912641069 1:111346563-111346585 CCCTCCCCGCGCTCCGCAGCTGG + Exonic
913592670 1:120343075-120343097 CCCTAGGAGAGGTCTCCAGCAGG + Intergenic
913650681 1:120912055-120912077 CCCTAGGAGAGGTCTCCAGCAGG - Intergenic
914170432 1:145217012-145217034 CCCTAGGAGAGGTCTCCAGCAGG + Intergenic
914525548 1:148460978-148461000 CCCTAGGAGAGGTCTCCAGCAGG + Intergenic
915292629 1:154896908-154896930 CCCCCACACAGCTCTCCAGCTGG - Intergenic
915730475 1:158050261-158050283 CCATCCCAGAGTTCTGCAGGGGG + Intronic
916216498 1:162399656-162399678 CCCACCCTGAGCCCTCCAACAGG + Intronic
919788417 1:201274955-201274977 CCCTCCCAGATGTCCCCAGCTGG - Intergenic
921133851 1:212242826-212242848 GACCCCCACAGCTCTCCAGCAGG - Intergenic
921462332 1:215444260-215444282 AACTTCCAAAGCTCTCCAGCAGG - Intergenic
922738693 1:228004034-228004056 CGCTCCCTGGGCCCTCCAGCAGG + Intergenic
922804361 1:228377927-228377949 CCCTCCAGGAGCTCTGGAGCTGG - Exonic
923015871 1:230126370-230126392 CCCTCTCAGAGCACCCCAGCGGG - Intronic
923063750 1:230499647-230499669 TCCTCCCAGTGCTCACCATCAGG - Intergenic
923160490 1:231310552-231310574 CCCTCCCTGAGCTCTCAGGGTGG + Intergenic
1064099834 10:12453985-12454007 CCCCCCCAGAGCTCTGCTGCTGG - Intronic
1065325232 10:24544970-24544992 CCTTCCCACAGGGCTCCAGCGGG + Exonic
1067069836 10:43123609-43123631 CCCTCACAGAGCCCTCCGGGGGG - Intronic
1069152535 10:64982102-64982124 AGCTTCCAGAGCACTCCAGCAGG + Intergenic
1069424668 10:68279011-68279033 CGCGCCCAGCGCTCTCCAGCCGG + Intergenic
1069606699 10:69743400-69743422 GCCTCCCAGCCCTCTCCTGCAGG - Intergenic
1069727829 10:70592655-70592677 GGCTCCCAGAGTTCTACAGCAGG - Intergenic
1069789497 10:71010678-71010700 CTCTCCCATGGCTCTCAAGCTGG - Intergenic
1069903209 10:71717644-71717666 CCCAGCCAGTGCTCTCCAGGTGG - Intronic
1071326663 10:84525388-84525410 TGCTCCCAGAGCTCTCAAGATGG + Intergenic
1072636443 10:97181477-97181499 GCCTCCCAGGCCTCTACAGCAGG + Intronic
1073282588 10:102365579-102365601 ACCTCACAAAGCTCTCCAACAGG - Exonic
1074440747 10:113475483-113475505 CCCTCCCAGCCCTCTCCCTCTGG - Intergenic
1075279307 10:121126183-121126205 CCTCACCAGAGCTCTTCAGCAGG + Intergenic
1075875766 10:125804380-125804402 CCCTTCCAGACCTCTTCATCTGG + Intronic
1076154013 10:128188938-128188960 CGCCCCCAGAGCTCTGCAGAAGG + Intergenic
1076590453 10:131578725-131578747 CCCTGCCAGAGACCTACAGCGGG + Intergenic
1076719032 10:132384912-132384934 CCCTCCCTGGGGTCTCTAGCAGG + Intergenic
1077319751 11:1935918-1935940 CCCTCCCAGAGCTGTCCCCAGGG + Intronic
1077339314 11:2018898-2018920 ACCTCTCGCAGCTCTCCAGCGGG + Intergenic
1077391376 11:2302091-2302113 CCCTCCCTGTGGTTTCCAGCTGG - Exonic
1077592749 11:3505286-3505308 ACCTCCCAGAGGTCCCCAGTGGG - Intergenic
1078539423 11:12201191-12201213 CACTCCCTGAAGTCTCCAGCTGG + Intronic
1078889191 11:15538769-15538791 GGCTCCCAGAGTTCCCCAGCAGG + Intergenic
1079115159 11:17635814-17635836 CCCCTCCAGAGCTCACCACCTGG - Intronic
1079242592 11:18731082-18731104 CCCTCCCTGAGCACATCAGCTGG + Intronic
1080575808 11:33598018-33598040 CCCCCCAAGAGCTCCCCACCAGG - Intronic
1081634588 11:44712348-44712370 CCCTCCCAGGGCCCTCCATATGG + Intergenic
1081730596 11:45369375-45369397 CCTTCCAGGAGCTCACCAGCTGG + Intergenic
1083439295 11:62665389-62665411 CCCGCCCAGAGCCTTCCACCCGG - Intronic
1083611697 11:64007467-64007489 CCCTTCCTGAGCTCTCCGCCCGG - Intronic
1084248579 11:67878006-67878028 ACCTCCCAGAGGTCCCCAGTGGG - Intergenic
1084278140 11:68066929-68066951 CACTCCCACAGCTTCCCAGCTGG - Intronic
1084782415 11:71418924-71418946 CCCACCCAGAGAACTGCAGCTGG - Intergenic
1084824246 11:71717470-71717492 ACCTCCCAGAGGTCCCCAGTGGG + Intergenic
1084860498 11:72014841-72014863 CCTGGCCAGAGCACTCCAGCAGG - Exonic
1084969173 11:72760553-72760575 CCCTCAAAGAGCTTTCCATCTGG + Intronic
1085385748 11:76157275-76157297 CCCTGCCAGGCCTCTGCAGCTGG - Intergenic
1085413041 11:76302840-76302862 CCCTGCCAGGGTTCTCCAGCAGG + Intergenic
1085691853 11:78670687-78670709 TCCAACCAGAGCTCTCCAACAGG + Intronic
1089329004 11:117676955-117676977 CCCTCCCAGTGCTCTCTACCCGG - Intronic
1089386362 11:118070822-118070844 CCTTCCCAGAGGTCCCCAGTGGG + Intergenic
1089561168 11:119343953-119343975 CCCTCCCCCAGCTCTGCACCTGG - Exonic
1089571992 11:119417218-119417240 CCAGCCCAGAGCTCTCCAAGGGG - Intergenic
1090258194 11:125300440-125300462 GCTTCCCACAGTTCTCCAGCTGG + Intronic
1090407607 11:126486511-126486533 CGCTCACAAAGCTCTCCAGCTGG + Intronic
1091252603 11:134156176-134156198 CCCTCCCAGAAGTCTCCGGGAGG + Intronic
1202822298 11_KI270721v1_random:74080-74102 ACCTCTCGCAGCTCTCCAGCGGG + Intergenic
1091589629 12:1835666-1835688 CCCTCTCACACCTCTCCTGCTGG + Exonic
1091980841 12:4862478-4862500 GCCTCCCAGAATCCTCCAGCTGG - Intergenic
1092418861 12:8313407-8313429 ACCTCCCAGAGGTCCCCAGTGGG - Intergenic
1094265962 12:28560177-28560199 CCAACCCAGAGCTCTCCCTCTGG + Intronic
1094544200 12:31389222-31389244 CCCTTCCAGAGCTCTCCTTTGGG - Intronic
1094794479 12:33955015-33955037 TTCTACCAGAGCTCTCCAGTTGG - Intergenic
1096472594 12:51888797-51888819 CCCTCCCATTGCTGTCCACCTGG - Exonic
1096774830 12:53957433-53957455 CCACCCCAGAGGTCCCCAGCTGG + Exonic
1097188687 12:57209325-57209347 GCCTTCCAGGCCTCTCCAGCTGG + Intronic
1100150941 12:91736773-91736795 CATTCTCAGAGCTCTCCAGAAGG + Intergenic
1100984439 12:100190812-100190834 CCCTCCCACAGGTCTTCTGCGGG - Intergenic
1101679984 12:106955697-106955719 CCCTCCCAGCAGTCCCCAGCCGG - Intronic
1101939475 12:109089355-109089377 CCCACCCAGGGTTCTCCACCAGG + Intronic
1102402735 12:112644355-112644377 CTCTCCCAGTGTTCCCCAGCAGG - Intronic
1103172429 12:118833175-118833197 GGCTCCCAGAGGTCCCCAGCAGG + Intergenic
1103405250 12:120670417-120670439 CACACCCAGAGCTCCCCAGCAGG - Intergenic
1103682018 12:122701782-122701804 CCCTGCTAGAGCTCACAAGCAGG + Exonic
1103683766 12:122715243-122715265 CCCTGCTAGAGCTCACAAGCAGG + Exonic
1103898446 12:124289953-124289975 CCCTGTCTGAGCTGTCCAGCCGG - Intronic
1105812623 13:24008481-24008503 CCCCTCCACAGCTCTCCAGGTGG + Intronic
1106230056 13:27814714-27814736 CCCTCCTAGAGCTCTTCTTCTGG + Intergenic
1106510713 13:30410082-30410104 CACTCCCACAGATCTCAAGCAGG - Intergenic
1106942813 13:34796112-34796134 CCCTAGCAGAGCTCTCCATGAGG - Intergenic
1107018674 13:35730019-35730041 CCCTCCCAGAGCTGGCCAGTGGG + Intergenic
1107966026 13:45598939-45598961 TCACCCCAGAGCTCTCTAGCAGG + Intronic
1108047448 13:46396625-46396647 TCCTCCCAGAGCTTTCCAAAAGG + Intronic
1108644435 13:52412358-52412380 CCCTTCCAAAGCCCTCCACCAGG + Intergenic
1110804313 13:79736695-79736717 CCCTGACAGGGCTTTCCAGCTGG - Intergenic
1111536739 13:89611757-89611779 TGCTCCCAGAGCTCTCAAGATGG + Intergenic
1112094906 13:96121729-96121751 GGCTCCCAGAGTTTTCCAGCTGG + Intronic
1113592627 13:111511958-111511980 CCCGCCCAGGGCATTCCAGCAGG + Intergenic
1113642769 13:111970084-111970106 CACTCACAGAACTCTCCAGAAGG + Intergenic
1113926210 13:113943080-113943102 CTCTCCCCGAGCTCTCCTGTGGG - Intergenic
1117440681 14:55756400-55756422 ACCTTCCAGAGATATCCAGCAGG - Intergenic
1117897460 14:60502721-60502743 CCCTGCCAGAGCTTTGCAGCTGG + Intronic
1119223366 14:72926599-72926621 CCCACCCCGAGCTCTGCAGCGGG - Intronic
1121394518 14:93608357-93608379 CCTTCCCTGATGTCTCCAGCTGG - Intronic
1121708207 14:96017089-96017111 GCCTACCAGACCTCTCCACCGGG + Intergenic
1121991827 14:98565343-98565365 CTCACCCAGAGCCTTCCAGCTGG - Intergenic
1122354302 14:101113957-101113979 CTCTTCCAGAGCTGTCCTGCAGG - Intergenic
1123007266 14:105329960-105329982 CCCTCCCAGGGCATCCCAGCTGG - Intronic
1124232502 15:27957418-27957440 CCCTCACTGAGCTCTGCAGGGGG - Intronic
1124626122 15:31308428-31308450 CCCGCCCACAGCTCTCCTGCTGG - Intergenic
1124721826 15:32117212-32117234 GTCTCCCAGAGCTCCCCAGTAGG - Intronic
1125985735 15:44049827-44049849 CCTTCCCAGAGTTCTCCAATTGG + Intronic
1127301970 15:57663520-57663542 ATCTCCCAGAGATCCCCAGCAGG - Intronic
1127599384 15:60520136-60520158 CACTCCCAGAACTTTTCAGCAGG - Intronic
1128033605 15:64503325-64503347 CCCTCCCCCATCTCTTCAGCTGG - Intronic
1128304003 15:66586314-66586336 CCCTCACAGAGCTCCCACGCAGG + Intronic
1128637723 15:69313878-69313900 CCCCCCCAGGACTCCCCAGCTGG - Intronic
1128657074 15:69470198-69470220 CACTTCCAGAGCCCTCCAACTGG - Intergenic
1128683906 15:69669800-69669822 CACACACAGAGCTGTCCAGCAGG - Intergenic
1128855236 15:71005401-71005423 CCCTCAAAGAGCTCTCAATCTGG - Intronic
1129323265 15:74786545-74786567 GCCTCCCAGAGCTTCCCAGGAGG + Intronic
1130012399 15:80161799-80161821 CCCTCCCTGCTCTCTCTAGCAGG - Intronic
1130063762 15:80588279-80588301 TCCACCCACTGCTCTCCAGCTGG + Intronic
1130106830 15:80935075-80935097 CTCTCCCAGGGCTCTTGAGCAGG - Intronic
1131636214 15:94235508-94235530 CCCTCCCAGTGATCTCCATAAGG - Intronic
1132013908 15:98299684-98299706 CCCACCCAGAGGGCTCCAGCCGG + Intergenic
1132426648 15:101723957-101723979 CCCTCCCAGTGCCCTGCGGCTGG - Intronic
1132515942 16:366161-366183 CCCTCCCAGGGCTCTGAACCAGG + Intergenic
1132739472 16:1404278-1404300 CCCTCACGGAGCTCCCCAGTTGG - Intronic
1134295836 16:12944964-12944986 CTCCCCCAGAGTTCTCCAGCAGG - Intronic
1134771231 16:16811447-16811469 CCCTCACTGAGCACTCCAGCAGG + Intergenic
1135510927 16:23082359-23082381 CCCTCACAGAGCCCATCAGCAGG + Intronic
1136220086 16:28823174-28823196 CGCTTCCCGCGCTCTCCAGCGGG + Exonic
1137533123 16:49296123-49296145 TGCTCCCAGAGGTCCCCAGCGGG - Intergenic
1138110179 16:54317607-54317629 CCCTCCAACCGCTCCCCAGCTGG - Intergenic
1139076217 16:63452079-63452101 CCCTCCCACAGCCTTTCAGCTGG + Intergenic
1140295380 16:73704804-73704826 GGCTCCCAGAGCTCCCTAGCAGG - Intergenic
1140602188 16:76490543-76490565 CACTGCAAGAGCTTTCCAGCTGG + Intronic
1140895505 16:79321175-79321197 CCCTACCAGAATTCTCCACCAGG + Intergenic
1141423205 16:83930523-83930545 CCCACCCAGAGCTCCCCACAAGG + Intronic
1141769909 16:86083520-86083542 CACTCCCAGAGCTCTCTGGGGGG + Intergenic
1141821794 16:86451197-86451219 TCCCCCCAGAGCTTTCCAGTGGG + Intergenic
1142131457 16:88433330-88433352 CCCGCCCAGGGCTCCCCAGGGGG + Exonic
1142178673 16:88656742-88656764 TCCTCCCACAGGGCTCCAGCAGG + Intronic
1142473647 17:177569-177591 GCCTGCCAGAGCTTTCCATCTGG + Intronic
1143483305 17:7239137-7239159 CCCTCCCCGAACTCCCCCGCTGG + Intronic
1143514256 17:7411509-7411531 CCTTCCCATAGCCCTCCAGTGGG + Intronic
1143590898 17:7885349-7885371 CGCGCCCAGCGCTCTCCAGCCGG - Intronic
1144344976 17:14341238-14341260 CCTTCCCTGAACTCTGCAGCCGG - Intronic
1144356452 17:14451362-14451384 CACTGCCAGTGCTCTCCAGCTGG - Intergenic
1144621817 17:16822967-16822989 CCATGCCGGTGCTCTCCAGCTGG - Intergenic
1144666644 17:17106618-17106640 GCATCCCGGATCTCTCCAGCAGG - Intronic
1144884604 17:18449747-18449769 CCATGCCGGTGCTCTCCAGCTGG + Intergenic
1145124645 17:20290138-20290160 GACTCTCAGAGCTCTCCTGCGGG + Intronic
1145147622 17:20494630-20494652 CCATGCCGGTGCTCTCCAGCTGG - Intergenic
1146256065 17:31392066-31392088 CCCTCCCCCAGCTCCCCCGCCGG + Intronic
1146305788 17:31728951-31728973 CCCTTCCAGAGCTCACAGGCTGG + Intergenic
1147560804 17:41507747-41507769 ACCTCCCAGAGCTGACAAGCAGG + Intergenic
1147872642 17:43598363-43598385 CCCTCCCACAGCTCACATGCAGG - Intergenic
1148438954 17:47701946-47701968 GCCTCCCAGATCTCTGCATCTGG + Intronic
1149600518 17:57890400-57890422 CCCTGCCAGTGCTCAGCAGCTGG - Intronic
1151669702 17:75565295-75565317 CCCTGCAGGAGCTCTCCAGGAGG + Intronic
1151705092 17:75763264-75763286 CCTTCCCTGAGGTCTCCAGGTGG - Intronic
1151786341 17:76276867-76276889 GCCTCCCAGAGCCCCCCAGGAGG - Intronic
1152699579 17:81812334-81812356 CCCTCCCAGCGCTCTCAGACAGG - Intronic
1152741674 17:82021120-82021142 CTCACCCAGAGCAGTCCAGCAGG + Intronic
1152753531 17:82077551-82077573 CCCTCCCCTGCCTCTCCAGCAGG + Intergenic
1152786218 17:82249398-82249420 CCCTCCCAGCGCTCTGGGGCTGG - Intronic
1153142121 18:1985044-1985066 GACTCCCAGAGTTCTCCAACAGG + Intergenic
1153591070 18:6674626-6674648 CCCACGCAGAGCTCTCTAGCTGG + Intergenic
1157601229 18:48894299-48894321 GCCTCCCAGGGCCCTCCACCTGG - Intergenic
1157616624 18:48991238-48991260 GCCTCCAAGAGCTCTCCTCCAGG + Intergenic
1157735439 18:50044621-50044643 CTATACCTGAGCTCTCCAGCAGG + Intronic
1158157583 18:54443182-54443204 CCCTCACAGAGCTCTTCCTCAGG + Intergenic
1158818055 18:61126804-61126826 CCATCCCAGACCTCTGCACCAGG + Intergenic
1160608668 18:80071378-80071400 CCCTCCCAGGGGTGACCAGCAGG - Intronic
1160608740 18:80071597-80071619 CCCTCCCAGGGGTGACCAGCAGG - Intronic
1160608812 18:80071816-80071838 CCCTCCCAGGGGTGACCAGCAGG - Intronic
1160608884 18:80072035-80072057 CCCTCCCAGGGGTGACCAGCAGG - Intronic
1160608993 18:80072364-80072386 CCCTCCCAGGGGTGACCAGCAGG - Intronic
1160609067 18:80072584-80072606 CCCTCCCAGGGGTGACCAGCAGG - Intronic
1161074185 19:2277051-2277073 CCCTCCCACACCTCTCTGGCCGG - Intronic
1161221743 19:3120978-3121000 CCCTCCCCCAGGTCCCCAGCGGG + Exonic
1161407538 19:4098948-4098970 CGCTCCCAGATCCCTCCAGCTGG + Intronic
1162017241 19:7852269-7852291 CCCTCCCCGCGTCCTCCAGCTGG + Intronic
1162019055 19:7860457-7860479 CCTCCCCAGAGCCCTTCAGCAGG - Intronic
1162057484 19:8073356-8073378 CACCCCCAGAGCCCTCCACCTGG + Intronic
1162328639 19:10013388-10013410 CCCTCCCACAGATCCCCTGCAGG - Exonic
1162739362 19:12765325-12765347 CCATCCCACAGCTCCCAAGCTGG + Intronic
1162917776 19:13883444-13883466 GACTACCAGAGCTCTCCAGTGGG + Intronic
1162957482 19:14107316-14107338 CCCTCCCTGGGCTCTGCACCCGG + Intronic
1163110012 19:15154157-15154179 GCCACCCAGAGGTCTCCAGTGGG - Intergenic
1164399665 19:27893927-27893949 GCCACCCAGAGCTCTTCACCAGG + Intergenic
1164438231 19:28250988-28251010 ACCTCCCAGAGGTCCCCAGTGGG - Intergenic
1165121036 19:33558716-33558738 CCCTCCCACAGACCTCAAGCTGG - Intergenic
1166732481 19:45067026-45067048 CCCTCCCAGAGCTCACCTCCCGG + Intronic
1166751199 19:45164732-45164754 CCCGCCCAGAGCTTTCCCACAGG - Intronic
1167120403 19:47513279-47513301 CCCTCCCAGACCTCTCCGCTCGG + Intronic
1167311154 19:48738827-48738849 CCCTCCCAGTCCCCTCCCGCGGG + Intronic
1168121508 19:54254659-54254681 CCAGCCCAGAGCTCTCCTGGGGG + Intronic
1168125016 19:54278183-54278205 CCAGCCCAGAGCTCTCCTGGGGG + Intronic
925712954 2:6759299-6759321 CCCTCCCAGGGCTCTCATGGCGG - Intergenic
925865784 2:8224699-8224721 CCCTCACAGAGCTTACCATCCGG - Intergenic
925987835 2:9230547-9230569 CCCTCCCACACCCCTCCTGCAGG - Intronic
926106552 2:10155733-10155755 CACTTCCAGTGCTCTCCAGCTGG + Intronic
926283007 2:11465756-11465778 CCGTCCCGGAGCTTACCAGCAGG + Exonic
927148766 2:20183964-20183986 TCCTCCCAGACCTCTCCTGTGGG - Intergenic
927163918 2:20298123-20298145 CCCTCACAAAGCACTCCATCTGG + Intronic
927201001 2:20578053-20578075 CCATGCCAGAGGTCCCCAGCCGG - Intronic
928359515 2:30651718-30651740 CATTCCCACAGCTCTCCAGGTGG - Intergenic
928389100 2:30895425-30895447 GCCTCCCACAGCCCTCCTGCTGG + Intergenic
929757430 2:44779072-44779094 GCCTCCCGGAGCTCTCAAGGAGG - Intergenic
930869107 2:56151838-56151860 CCCTCCTAGAGTTCCCCAGGAGG - Intergenic
931460599 2:62447251-62447273 CCCTCTGAGAGCTCTGCATCAGG + Intergenic
931714669 2:65019715-65019737 CCGTCCCTGAGCTGGCCAGCTGG + Intronic
931769959 2:65488927-65488949 GTCTCCCAGAGGTCCCCAGCAGG - Intergenic
931770193 2:65490752-65490774 CTCTCCCAGAGCTGTCAAACTGG - Intergenic
934852005 2:97707483-97707505 CCCTCCCAGAGCTCTCCACTGGG + Intergenic
934934026 2:98451621-98451643 CCCTCCCATAGCCCTCACGCAGG + Intronic
935800596 2:106691429-106691451 TACTCCCAGAGCTCCCCAGCGGG - Intergenic
936042288 2:109159224-109159246 CCCTCCCTGTGCTCTGCTGCTGG + Intronic
938395737 2:130946572-130946594 CTCTCCCAGAGTGCTCCAACGGG + Exonic
939560077 2:143721474-143721496 CCCTGCCACAGCACTACAGCTGG - Intronic
939779213 2:146423774-146423796 CCCACCCACAGCCCTCCAACAGG - Intergenic
941640663 2:167984324-167984346 CCTACCCAGAACTCTCCAGGTGG - Intronic
942026279 2:171913678-171913700 CCCTCTCACTTCTCTCCAGCAGG - Intronic
942097598 2:172548189-172548211 ACCAGCCAGAGGTCTCCAGCTGG + Intergenic
943351965 2:186806390-186806412 CCCTACTTGAGCTCTCTAGCTGG - Intergenic
944841051 2:203624077-203624099 CCCCATCAGAGCCCTCCAGCAGG - Intergenic
944995328 2:205287544-205287566 CTGTCCCAGAGCTCACCAGGGGG + Intronic
946413915 2:219529888-219529910 GACTCCCAGAGCACTGCAGCAGG + Intronic
947206653 2:227667150-227667172 CTCTCCCAGACCTCCCCATCTGG + Intergenic
947617936 2:231570146-231570168 ACCTCCCGGAGCTCTCGGGCAGG + Intergenic
948248809 2:236508414-236508436 CCCTCCCAAAGCCCTTCAGGGGG + Intergenic
948289638 2:236815784-236815806 GGCTCCCAGGGCTCTCCAGCAGG + Intergenic
948592426 2:239059920-239059942 CCCCCGGAGAGCTCTCCTGCAGG - Intronic
1168836083 20:878293-878315 CCCAGCCAGTGCTCCCCAGCTGG + Exonic
1170473467 20:16691057-16691079 GCCTCCCAGAGTTCCCCAACAGG - Intergenic
1170787419 20:19479660-19479682 GTCTCCCAGAGCTCTCCAGCTGG - Intronic
1170871111 20:20207467-20207489 GGCTTCCAGAGCTCTGCAGCAGG - Intronic
1170893067 20:20392111-20392133 CCCACCCAGGGCGCCCCAGCAGG + Intronic
1170959936 20:21016271-21016293 ACCTCCCAGAGGTCCCCAGCAGG + Intergenic
1172073616 20:32277526-32277548 CCCGCCCAGACCCCTCCAGCCGG + Intergenic
1172153668 20:32808648-32808670 CCCTTCCTGAGCTCCCCAGAGGG - Exonic
1172161574 20:32872445-32872467 CCATCCCAGAGCTCTCAGGCTGG + Intronic
1172393282 20:34581126-34581148 CCTACCCAGTGCTGTCCAGCAGG - Intronic
1172597192 20:36157584-36157606 CCCTCACACACCTCTCCACCTGG - Intronic
1176100991 20:63364510-63364532 CACAACCAGCGCTCTCCAGCGGG - Intronic
1176145148 20:63562190-63562212 CCCTCTCAGTGATCCCCAGCAGG - Exonic
1176159957 20:63642796-63642818 TCCTCCCAGGGGTCACCAGCCGG - Intronic
1178937946 21:36880824-36880846 CCCTCCCAGAGCACTCCTTAGGG + Intronic
1179148227 21:38787734-38787756 CCTTCCCTGAGCTCTCCAGGTGG - Intergenic
1179451429 21:41470895-41470917 CCCTGCCAGACCTCTCCTTCTGG + Intronic
1179502500 21:41819262-41819284 CCCTTCCAGAGCCCTGCAGCTGG + Intronic
1179535756 21:42050384-42050406 CCCTCTCAGAGCTCTCAGTCTGG - Intergenic
1179896153 21:44364804-44364826 CCCTCACAGCGCTCTCCTGCAGG - Intronic
1180230083 21:46421923-46421945 CCCACCCACAGCTCTCCAGGGGG - Intronic
1180955424 22:19739212-19739234 CCCACCCAGGTCTCTCCAGAGGG + Intergenic
1181322936 22:22022655-22022677 CCCTCCCTGAGCCCTGGAGCTGG - Intergenic
1181625759 22:24121138-24121160 TCCTCCTAGAGGTCTCCTGCTGG + Intronic
1181973453 22:26711272-26711294 GCCTCCCAGAGGTCCCCAGCAGG - Intergenic
1182038336 22:27216725-27216747 GCCTACCAGAGTTCCCCAGCAGG + Intergenic
1182179205 22:28327759-28327781 CTCTCCTAGAGCTCTAAAGCAGG + Intronic
1182551519 22:31103397-31103419 AGCTCCCAGAGCTCTGAAGCTGG - Intronic
1182621848 22:31622756-31622778 TGGTCCCAGAGCTCTCCGGCAGG + Intronic
1184979908 22:48088794-48088816 CCCCCCCAGAGCCATCCCGCAGG - Intergenic
1185127225 22:49017972-49017994 CTGTCCCAGAGCACTGCAGCTGG - Intergenic
1185258198 22:49848350-49848372 CCCACCCAGAGTTCTCCCCCTGG + Intergenic
949976789 3:9468038-9468060 CCCTCCCAGTGCTATCCAGGGGG - Intronic
950443121 3:13021362-13021384 ACCCCCCACAGCTGTCCAGCTGG + Intronic
950462861 3:13135608-13135630 CAGCCCCAGAGCTCTCCAGTGGG + Intergenic
950731809 3:14966273-14966295 CTCTCCCAGAGCTCTCTAACGGG + Intronic
950813546 3:15673918-15673940 GCCTCCCAGAGTGCTCCACCTGG - Intronic
950967259 3:17154939-17154961 CCCTTCCGGGGCTCCCCAGCTGG + Intergenic
953393070 3:42545157-42545179 TTCTCACAGAGCTGTCCAGCAGG - Intergenic
953813338 3:46132941-46132963 CCCTCACAGAGCTGGCCAGGTGG - Intergenic
954330978 3:49890133-49890155 ACCTCCCAGAGTCCTTCAGCTGG + Intronic
954653052 3:52177009-52177031 CTGTCCCACAGCTCTCCAGCAGG - Intergenic
954909061 3:54087905-54087927 CCCTCCCCGAGGGCACCAGCCGG + Intergenic
955031989 3:55230873-55230895 CCCTCCCAGAGATCCTCAGCAGG - Intergenic
955910869 3:63859068-63859090 TCCTCCAAGAGCTTTCCAGGAGG + Intronic
956086359 3:65615316-65615338 CCCACCCAAAGATTTCCAGCAGG + Intronic
956115575 3:65914613-65914635 CCTTCCCAGAGCTCTCAAACTGG - Intronic
957062828 3:75495960-75495982 ACCTCCCAGAGGTCCCCAGTGGG - Intergenic
961135029 3:124502314-124502336 CCCTTCCAGAGCTCTGCAGTAGG + Intronic
961701927 3:128751181-128751203 CCCACACAGAGCTCTCCACAGGG + Intronic
961896543 3:130172629-130172651 ACCTCCCAGAGGTCCCCAGTGGG - Intergenic
962029653 3:131586429-131586451 GTTTCCCAGAGTTCTCCAGCAGG - Intronic
964680331 3:159331197-159331219 GTCTCCCAGAGCTCCCCATCAGG - Intronic
965548109 3:169935820-169935842 CCCTACCGGACCTTTCCAGCAGG - Intronic
965610508 3:170538734-170538756 CCCTCCAGGAGCTCTCAGGCTGG + Intronic
965717173 3:171617449-171617471 CCCTCCCAGAGATCACTGGCTGG - Intronic
967511592 3:190319805-190319827 CCATCCCAGATCTCTACAGCTGG + Intronic
968079752 3:195837708-195837730 CACAGTCAGAGCTCTCCAGCAGG + Intergenic
968145194 3:196292731-196292753 ACCACCCAGAGTTCTCCAACAGG + Intronic
968154418 3:196367671-196367693 CCCTCCCAGAGCTGCCCCTCAGG + Intronic
968899055 4:3422296-3422318 ACCTCCCAGAGCAGCCCAGCTGG - Intronic
969006724 4:4026094-4026116 ACCTCCCAGAGGTCCCCAGTAGG - Intergenic
969241044 4:5897871-5897893 CCCTCCGGAAGCTCTTCAGCAGG - Intronic
969806253 4:9611325-9611347 ACCTCCCAGAGGTCCCCAGTGGG + Intergenic
970616697 4:17774403-17774425 CCCTCCCAGCACTCTCCAGCTGG - Intronic
971179603 4:24316898-24316920 ACCTTCCACAGCCCTCCAGCAGG + Intergenic
972177083 4:36420597-36420619 GCCAGCCAGAGATCTCCAGCTGG - Intergenic
976155914 4:82144699-82144721 GGCTCCCAGAGATCCCCAGCAGG + Intergenic
978030835 4:103938686-103938708 CACTCCCTTAGCTGTCCAGCTGG - Intergenic
979182036 4:117742139-117742161 CCCTCACACAGCTGTCTAGCTGG - Intergenic
982137744 4:152288206-152288228 TCCTCCCAGGGGTTTCCAGCCGG + Intergenic
983547466 4:168978885-168978907 CCCTGCCTGAGCTCTCAGGCTGG + Intronic
984101707 4:175495185-175495207 CGCTCCCAGAGCCCTCCTGCAGG - Intergenic
985782746 5:1879664-1879686 CCCTCACACAGGTCTCCACCTGG - Exonic
986151351 5:5133105-5133127 GCCTCCCCCAGCTCTCCTGCTGG + Intergenic
986243029 5:5978642-5978664 CTGCCCCAGAGCTCTCCAGAAGG - Intergenic
986287387 5:6369966-6369988 GCCTTCCAGAGCTCTCCACCCGG - Intergenic
986580883 5:9264660-9264682 CCCACCCTGAGGTCACCAGCGGG + Intronic
987009868 5:13751686-13751708 CCCTCCCTGCTCTCTCAAGCCGG - Intronic
987308578 5:16661164-16661186 TGCTCCCAGCGCTCTCCACCAGG + Intergenic
987366537 5:17153699-17153721 GCCTCCCAGAGTTCCCCAGTGGG - Intronic
988606134 5:32679879-32679901 CCCACCAAGAGCTCTGGAGCTGG - Intergenic
989982941 5:50665804-50665826 CCCTAGGAGAGGTCTCCAGCAGG - Intergenic
990503632 5:56423061-56423083 GGCTCCCAGAGCTCCCCAGTGGG + Intergenic
993591011 5:89794998-89795020 TTCTCCCAGAGCTCTCAAGATGG - Intergenic
994644465 5:102451275-102451297 CCCTGCCTGAGCTCTCAGGCTGG - Intronic
995732968 5:115265366-115265388 GCCTCCACGAGCTCTGCAGCTGG + Intergenic
996128343 5:119751914-119751936 TGCTCCCAGAGCTCCCCAGACGG - Intergenic
997500689 5:134371335-134371357 CCTTCCCCGAGCCCTTCAGCGGG - Exonic
998122064 5:139586994-139587016 TGCTCCCAGAGCTCTCAAGATGG + Intronic
998396242 5:141820188-141820210 CTATCCCAGAGCTCCCCAACTGG - Intergenic
1000339642 5:160267087-160267109 CCCTCCCAGAGCTCACATCCTGG - Intronic
1001304579 5:170562386-170562408 CCCTCACAGAGCTCACGTGCTGG - Intronic
1001701212 5:173707729-173707751 CCCTCCCAGAGCTCTCAGCATGG + Intergenic
1001787953 5:174430137-174430159 CCCTCCCCGACCTCTCCTGCTGG - Intergenic
1001932813 5:175685148-175685170 CCCTCCCAGAGGGCACCAGGCGG + Intronic
1002176866 5:177405578-177405600 CCTTCCCAGAACTCTCCCTCTGG + Intronic
1002617235 5:180463565-180463587 CCCTGCTAGACCTCTCCACCAGG - Intergenic
1005816719 6:29558950-29558972 TGCTCCCAGAGCTCTCAAGATGG - Intronic
1005838609 6:29725371-29725393 CCCTTCTGGAGCTCTTCAGCAGG + Intronic
1006510482 6:34518632-34518654 CCCTCCCAGAGCTCTCCAGCGGG - Intronic
1006574837 6:35037543-35037565 GTCTCCCAGAGTTCCCCAGCAGG - Intronic
1006814862 6:36843255-36843277 GTCTCCCAGAGTTCTGCAGCAGG - Intergenic
1007108529 6:39299609-39299631 CCCTCCCTGGCGTCTCCAGCTGG + Exonic
1007113741 6:39328764-39328786 GTCTCCCAGAGGTCCCCAGCGGG - Intergenic
1008294361 6:49757433-49757455 CCCTGCCAGTGTTTTCCAGCTGG - Intergenic
1008848781 6:55998789-55998811 CCCTTGCAAATCTCTCCAGCTGG - Intergenic
1010465818 6:76166001-76166023 CCCTGCCTGGGCTCTCCGGCTGG + Intergenic
1010623785 6:78110898-78110920 CCTTCCCAGAAAGCTCCAGCTGG + Intergenic
1010980384 6:82364212-82364234 CCCGCCCAGACCTCTCCACCAGG - Intronic
1013651071 6:112195104-112195126 TCCTCCCAGGGCTATACAGCTGG + Intronic
1015220618 6:130801448-130801470 CGCGCCCAGCGCTCTCCAGCCGG + Intergenic
1017724553 6:157267907-157267929 CGCACCCAGAACTCCCCAGCCGG - Intergenic
1019352736 7:562536-562558 CCCTTCCAGCCCTCTCCACCAGG + Intronic
1019441546 7:1050015-1050037 CCCTCCCAGGTCTCTCTGGCGGG + Intronic
1019479012 7:1257503-1257525 CGCACCCAGAGCTCTCGTGCAGG + Intergenic
1019513940 7:1431582-1431604 CCACCCCAGAGCTCACCAGAAGG + Intronic
1019812449 7:3174698-3174720 CCTTCCTAGAGCTACCCAGCAGG - Intergenic
1019951326 7:4375428-4375450 CCCTCCCAGAGTTCACCTGCAGG - Intergenic
1020148764 7:5665595-5665617 CTCTCCCAGAGCAGTCAAGCTGG - Intronic
1020327231 7:6984239-6984261 ACCTCCCAGAGGTCCCCAGTGGG - Intergenic
1022392271 7:29953737-29953759 CCCTCGCAGACCTCTCCATCAGG + Intronic
1022404974 7:30080460-30080482 CCATCCTAGAGATCTGCAGCAGG - Exonic
1023093701 7:36639815-36639837 CCCTCCCAGAGCTTTCTCCCTGG + Intronic
1026760647 7:73123380-73123402 GCCTCCCAGAGGTCCCCACCAGG + Intergenic
1027036991 7:74932201-74932223 GCCTCCCAGAGGTCCCCACCAGG + Intergenic
1027086573 7:75269258-75269280 GCCTCCCAGAGGTCCCCACCAGG - Intergenic
1029392873 7:100287261-100287283 GCCTCCCAGAGGTCCCCACCAGG - Intergenic
1029480475 7:100809427-100809449 TCCTGCCAAAGCCCTCCAGCGGG + Intronic
1029536939 7:101162796-101162818 AACTCCCAGAGCTCACCCGCGGG - Exonic
1030431313 7:109452523-109452545 CGCTCCCAGAGCTCCCAAGATGG - Intergenic
1030661214 7:112221378-112221400 TCCTCCCAGAGCTCCCGAGATGG - Intronic
1030689963 7:112522275-112522297 GGCTCTCAGATCTCTCCAGCTGG + Intergenic
1031300329 7:120056105-120056127 CCTTTCCTGAGCTCTGCAGCCGG + Intergenic
1031334814 7:120515292-120515314 CCCTCCCTGATCTCTCCATCTGG + Intronic
1032463545 7:132129150-132129172 CCCTCCCAGATCTGACAAGCTGG + Exonic
1033834121 7:145288250-145288272 CCCTCTCAGAACTCTCCTTCAGG - Intergenic
1034224148 7:149469955-149469977 CCTTCCCTGATCTCTCCAGGTGG - Intergenic
1034445196 7:151110547-151110569 CCCTGCAATGGCTCTCCAGCTGG - Intronic
1035341341 7:158164604-158164626 CCCTCACCCGGCTCTCCAGCTGG + Intronic
1035582724 8:749980-750002 CCATCTCAGATCTCTCAAGCAGG + Intergenic
1035612193 8:973921-973943 TGCGCCCAGCGCTCTCCAGCCGG - Intergenic
1035750778 8:1994600-1994622 CCCTCCCAGAAGGCTCCTGCGGG + Intronic
1036753920 8:11460146-11460168 CCCTCCCAGAGCCCTGTAGTGGG - Intronic
1041265836 8:56063643-56063665 CCCTTCCACTGCACTCCAGCTGG + Intergenic
1042236108 8:66614165-66614187 CCCTCCCTGGTCTCTCCAGAGGG - Intronic
1042844058 8:73152738-73152760 TCCTCACAGAGCTGTCCAGAGGG + Intergenic
1045749771 8:105469466-105469488 CCTGCCCATTGCTCTCCAGCTGG + Intronic
1046487692 8:114908864-114908886 CCCTGCCTGAGCTCTCTGGCAGG + Intergenic
1048262442 8:132956460-132956482 GCTTCCCTGAGCTCTCCAGCTGG - Intronic
1048712356 8:137226661-137226683 GCCAGCCAGAGGTCTCCAGCTGG - Intergenic
1049205935 8:141363635-141363657 CCTGCCCAGAGGCCTCCAGCGGG + Intronic
1049271261 8:141697473-141697495 CCTTCCCGGAGATCCCCAGCAGG - Intergenic
1049362908 8:142220733-142220755 CCCTCGCACAGCGCCCCAGCCGG + Intronic
1049383165 8:142327546-142327568 CCCTCACAGAGCCCTCCATCGGG + Intronic
1049514077 8:143044340-143044362 CCCTCCCAGTGCCCAGCAGCAGG - Intronic
1049569259 8:143360764-143360786 CTCTCCCAGAGGCCTCCAGGAGG - Intergenic
1049769219 8:144372136-144372158 CCCATCCAGAGCCCTGCAGCCGG + Intergenic
1050590495 9:7155240-7155262 CCCTCTTACAGGTCTCCAGCTGG - Intergenic
1051361420 9:16285000-16285022 CCCTTCCAGAGCTCTCTGGGTGG - Intergenic
1054521449 9:66077626-66077648 CCCTCCCACAACCCTACAGCCGG + Intergenic
1055208673 9:73763079-73763101 CCCAACAAGAGCTCTCAAGCCGG + Intergenic
1056796963 9:89665206-89665228 CCCTCCCAGGTCTCTGCAGCAGG - Intergenic
1057139076 9:92716017-92716039 CCCTCCCACAGCTCCGCACCCGG - Intronic
1057839790 9:98477089-98477111 CCCTCCCAAAACTCCCCAACTGG - Intronic
1057873190 9:98733375-98733397 TCCACCCTGAGCTCTCCTGCAGG - Exonic
1060337277 9:122737349-122737371 CCCTCCCCCAGCCCTCCACCCGG + Intergenic
1060375997 9:123115487-123115509 CCCTCCCTGTACTCTCCATCTGG + Intronic
1060821784 9:126665503-126665525 CCCTCCCAGAGCAGCCCCGCTGG - Intronic
1061468926 9:130807103-130807125 TCCTGCCACAGCACTCCAGCTGG + Intronic
1061836568 9:133333577-133333599 CTCTCCCAGAGCACACCTGCTGG + Intronic
1062249354 9:135586570-135586592 CCTTCCCAGAAGTCTCCAGAAGG - Intergenic
1062254954 9:135616489-135616511 CCCTCTCAGGGCTCTCCACCAGG - Intergenic
1062423225 9:136494033-136494055 CCCTCAGGGAGCTCTGCAGCAGG - Intergenic
1062459265 9:136656035-136656057 CCCCCCCAGAGCCCCCCAGAGGG - Intergenic
1186274152 X:7921805-7921827 TCCTCCCAGCGCTCACGAGCTGG - Exonic
1187520168 X:20006077-20006099 CCCTCCCAGAGGTCTGCATATGG + Intergenic
1187964208 X:24594741-24594763 GCTGCCCAGAGCTCTCCATCTGG - Intronic
1189185280 X:39049506-39049528 CTCTCCCAGAGGTGTCCAGTGGG + Intergenic
1189232651 X:39464489-39464511 CCCTCCCAGTCCTCTTAAGCAGG - Intergenic
1189238652 X:39508365-39508387 GTCTCCCGGAGTTCTCCAGCAGG + Intergenic
1189269982 X:39744431-39744453 GTCTCCTAGAGCTCCCCAGCTGG - Intergenic
1189429034 X:40931006-40931028 TTCTCACAGAGCTCTCCAGTGGG - Intergenic
1189541904 X:42000373-42000395 CTCTCCTAGAGGTCCCCAGCAGG - Intergenic
1189707294 X:43771660-43771682 GCCTCCTAGAGGTCTCCAGCTGG - Intronic
1189834904 X:45009757-45009779 GTCTCCCAGAGATCTCCAGCAGG + Intronic
1190283481 X:48946729-48946751 CCCAGCCAGGGGTCTCCAGCAGG + Intronic
1191224820 X:58031820-58031842 CCTTCCCAGGGCTCTCAGGCTGG - Intergenic
1192211724 X:69132110-69132132 CCCTCTCCGAGCTCACCATCTGG - Intergenic
1192543996 X:71997550-71997572 CTTTCCCATAGCTCTCCAGGAGG + Intergenic
1193211302 X:78810211-78810233 TCCTACCAGTGCACTCCAGCTGG + Intergenic
1194010405 X:88554189-88554211 CCCTGCCTGAGGACTCCAGCAGG - Intergenic
1194366338 X:93018777-93018799 CCCTGTCTGAGCACTCCAGCTGG + Intergenic
1198398889 X:136251121-136251143 CCATCCCAGGGCACTCCGGCGGG + Intronic
1199677903 X:150203194-150203216 ACTTCCCAGAGGTCTCCAGATGG + Intergenic
1200674563 Y:6135039-6135061 CCCTGTCTGAGCACTCCAGCTGG + Intergenic
1202062430 Y:20901167-20901189 TCCTCCCAGAGCTCCCAAGATGG - Intergenic