ID: 1006510484

View in Genome Browser
Species Human (GRCh38)
Location 6:34518633-34518655
Sequence CCCCTCCCAGAGCTCTCCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 351}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006510484_1006510492 16 Left 1006510484 6:34518633-34518655 CCGCTGGAGAGCTCTGGGAGGGG 0: 1
1: 0
2: 4
3: 46
4: 351
Right 1006510492 6:34518672-34518694 GACTCAGTCCAGGAGGGCAGGGG 0: 1
1: 0
2: 4
3: 31
4: 374
1006510484_1006510490 14 Left 1006510484 6:34518633-34518655 CCGCTGGAGAGCTCTGGGAGGGG 0: 1
1: 0
2: 4
3: 46
4: 351
Right 1006510490 6:34518670-34518692 TTGACTCAGTCCAGGAGGGCAGG No data
1006510484_1006510486 6 Left 1006510484 6:34518633-34518655 CCGCTGGAGAGCTCTGGGAGGGG 0: 1
1: 0
2: 4
3: 46
4: 351
Right 1006510486 6:34518662-34518684 ACACACCTTTGACTCAGTCCAGG No data
1006510484_1006510493 22 Left 1006510484 6:34518633-34518655 CCGCTGGAGAGCTCTGGGAGGGG 0: 1
1: 0
2: 4
3: 46
4: 351
Right 1006510493 6:34518678-34518700 GTCCAGGAGGGCAGGGGAGCTGG 0: 1
1: 0
2: 7
3: 94
4: 808
1006510484_1006510494 23 Left 1006510484 6:34518633-34518655 CCGCTGGAGAGCTCTGGGAGGGG 0: 1
1: 0
2: 4
3: 46
4: 351
Right 1006510494 6:34518679-34518701 TCCAGGAGGGCAGGGGAGCTGGG 0: 1
1: 0
2: 6
3: 80
4: 601
1006510484_1006510487 9 Left 1006510484 6:34518633-34518655 CCGCTGGAGAGCTCTGGGAGGGG 0: 1
1: 0
2: 4
3: 46
4: 351
Right 1006510487 6:34518665-34518687 CACCTTTGACTCAGTCCAGGAGG No data
1006510484_1006510491 15 Left 1006510484 6:34518633-34518655 CCGCTGGAGAGCTCTGGGAGGGG 0: 1
1: 0
2: 4
3: 46
4: 351
Right 1006510491 6:34518671-34518693 TGACTCAGTCCAGGAGGGCAGGG 0: 1
1: 0
2: 0
3: 49
4: 725
1006510484_1006510488 10 Left 1006510484 6:34518633-34518655 CCGCTGGAGAGCTCTGGGAGGGG 0: 1
1: 0
2: 4
3: 46
4: 351
Right 1006510488 6:34518666-34518688 ACCTTTGACTCAGTCCAGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 114
1006510484_1006510496 24 Left 1006510484 6:34518633-34518655 CCGCTGGAGAGCTCTGGGAGGGG 0: 1
1: 0
2: 4
3: 46
4: 351
Right 1006510496 6:34518680-34518702 CCAGGAGGGCAGGGGAGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006510484 Original CRISPR CCCCTCCCAGAGCTCTCCAG CGG (reversed) Intronic
900274585 1:1815973-1815995 CCCTTCCCACAGTTCTCCAGTGG + Intronic
900280377 1:1863444-1863466 CCACTCCCAAACCCCTCCAGTGG - Intronic
900468326 1:2836792-2836814 CCCCTCCCAGCCCACTGCAGAGG + Intergenic
900787509 1:4657981-4658003 GCCCTGCCAGAGCTCACCCGTGG + Intronic
900808267 1:4781978-4782000 CACCTCCCACATCTCCCCAGAGG - Intronic
901630521 1:10645941-10645963 CCCTGCCCAGGGGTCTCCAGGGG + Intronic
901669918 1:10850092-10850114 CCACTCCCAGCCCTTTCCAGGGG - Intergenic
902041699 1:13497183-13497205 CTCGGCTCAGAGCTCTCCAGGGG - Intronic
902081621 1:13824835-13824857 CACTTCCCAGAGCTCACCATGGG - Exonic
902178332 1:14668523-14668545 CCTCTCCCAGAGCCCACCTGGGG + Intronic
903033509 1:20479895-20479917 CCCCTCCCTGCTCTCTGCAGAGG + Intergenic
903044471 1:20554551-20554573 ACTCTCCCAGTGTTCTCCAGAGG - Exonic
903278042 1:22233929-22233951 GCCCTCCCAGGGCTCTGCTGAGG - Intergenic
903550295 1:24153310-24153332 TGACTTCCAGAGCTCTCCAGGGG + Intergenic
903781507 1:25823048-25823070 CGCCTCCCGGAGCTGCCCAGTGG + Exonic
903816381 1:26067184-26067206 CCCCTCTCAGCCCTGTCCAGAGG + Intronic
903928583 1:26849295-26849317 CCCCTCTCCCTGCTCTCCAGAGG + Intronic
903972406 1:27127603-27127625 CCCAGGCCAGAGCCCTCCAGTGG - Intronic
904254996 1:29249252-29249274 CCCCTCCCACACTCCTCCAGAGG + Intronic
904771713 1:32884720-32884742 CCCACCCCAGGGCCCTCCAGTGG - Intergenic
904896501 1:33822066-33822088 TCCCCACCAGAACTCTCCAGCGG - Intronic
905449392 1:38046946-38046968 GGCCGCCCAGAGCTCTCCATTGG + Intergenic
905536315 1:38724822-38724844 CCCCTCCCAGAGCTGTTGTGAGG + Intergenic
905599605 1:39238405-39238427 CCCCTTCCTGAGCTCCCCAGAGG + Intronic
905678324 1:39846183-39846205 TCTCTGCCTGAGCTCTCCAGTGG - Intronic
908332026 1:63080659-63080681 GGCTTCCCAGAGTTCTCCAGAGG - Intergenic
910001198 1:82344376-82344398 CCCCTCTCAAAGTTCTTCAGTGG - Intergenic
911182243 1:94871436-94871458 TCCCTCCCAGCACTTTCCAGGGG + Intronic
913346028 1:117812077-117812099 CCCCTCCCAGTGCTCTGTGGAGG - Intergenic
915248146 1:154570396-154570418 TCCCTCCCTGAGCCCTCCAATGG - Intronic
915301063 1:154951909-154951931 CTCCTCCCAGAGCCTGCCAGTGG - Exonic
915730473 1:158050260-158050282 CCCATCCCAGAGTTCTGCAGGGG + Intronic
918040036 1:180908344-180908366 CCCCTCCCAAAACCCTCCCGCGG - Intergenic
918340900 1:183567332-183567354 CCCCTTCCAGAGCCCTGCAGAGG + Exonic
918544029 1:185661905-185661927 GCACTCCCAGAGGGCTCCAGAGG + Intergenic
920172649 1:204081513-204081535 CCACCCCCAGAGCCCGCCAGGGG - Intronic
921046424 1:211481103-211481125 CCCATCCCAGTGCTCACCTGAGG + Exonic
921259686 1:213374832-213374854 CCCCTCCCAGAGGCCTCTGGAGG - Intergenic
921289780 1:213646726-213646748 TGCCTCCCTGAGCTCTCCTGAGG + Intergenic
923015873 1:230126371-230126393 TCCCTCTCAGAGCACCCCAGCGG - Intronic
1063172139 10:3518203-3518225 CCCCTCCCATAGCAGTCCAGAGG - Intergenic
1063973295 10:11396414-11396436 CCCTTCCCAGAGCTCTCGGTCGG + Intergenic
1067069838 10:43123610-43123632 GCCCTCACAGAGCCCTCCGGGGG - Intronic
1067782319 10:49217825-49217847 TCCCTCCCAGGGCTCTCCATTGG + Intergenic
1069863667 10:71486889-71486911 CCCTCCCCAGGGCTCCCCAGAGG - Intronic
1070487681 10:76946231-76946253 CCCATGCCATAGCTCCCCAGTGG + Intronic
1070546791 10:77458746-77458768 CATCTCCCAGAGGTCTCCAGTGG - Intronic
1071202414 10:83234958-83234980 CCCATCCCAAAGCTATCTAGGGG - Intergenic
1072610942 10:97017433-97017455 ACCCTCCCAGAGCTTTTCTGAGG - Intronic
1072736003 10:97880179-97880201 GCCTACCCAGAGCTCCCCAGTGG + Intronic
1072900718 10:99404301-99404323 CTCCTCAAAGAGCTCTCCACAGG + Intronic
1073101260 10:101007912-101007934 CCCCTCATAGAGCTCTCTTGGGG + Intronic
1073307641 10:102515715-102515737 CTCCTCCTAGAGCTCTCATGAGG + Intronic
1074119258 10:110481333-110481355 CCCCTCCCAGAGGAAGCCAGAGG + Intergenic
1074123821 10:110512655-110512677 CCCTTCCCCCAGCTCTCCAGTGG + Intergenic
1074350713 10:112734146-112734168 CCCTTCTCAGTACTCTCCAGTGG + Intronic
1074897561 10:117790685-117790707 TCCTTCCCAGAGCTCTGCTGGGG - Intergenic
1076025117 10:127105587-127105609 ATCCTCACAGAGCTCTGCAGGGG + Intronic
1076056158 10:127374859-127374881 CCCCCCCTAGAGCTTTCTAGGGG + Intronic
1076618354 10:131771363-131771385 CTCCTTCCAGAGCTCTGCCGTGG + Intergenic
1077095150 11:796003-796025 CCCCTCCCTGGGCCCCCCAGAGG + Intronic
1077319749 11:1935917-1935939 TCCCTCCCAGAGCTGTCCCCAGG + Intronic
1077592750 11:3505287-3505309 CACCTCCCAGAGGTCCCCAGTGG - Intergenic
1077889738 11:6410633-6410655 CCCCTCCTATGGCTCCCCAGAGG - Exonic
1078421184 11:11214354-11214376 CAAAGCCCAGAGCTCTCCAGGGG - Intergenic
1078657588 11:13256100-13256122 CCCCTCACAGAGTTCTCTACTGG - Intergenic
1078718444 11:13861370-13861392 CTTCTCCCAGAGCTCTACACAGG - Intergenic
1082041632 11:47690362-47690384 CCCATCCCAGACCCCTCAAGAGG - Exonic
1083162942 11:60866986-60867008 CACCTCCAAGGGCTCTCCTGAGG - Intergenic
1083583230 11:63838751-63838773 CCCCTCCCACAGCCCTGCCGAGG - Intergenic
1084014836 11:66372017-66372039 CCCCGCCGAGAGCTCTGTAGGGG + Intronic
1084192938 11:67507049-67507071 CCCCACCCACTGCCCTCCAGAGG + Intronic
1084248580 11:67878007-67878029 CACCTCCCAGAGGTCCCCAGTGG - Intergenic
1084519607 11:69655421-69655443 CTCCTCCCAGGGCTCAACAGTGG + Intronic
1084824245 11:71717469-71717491 CACCTCCCAGAGGTCCCCAGTGG + Intergenic
1084837506 11:71813580-71813602 GCCCTCCCAGAGCCCCGCAGAGG - Intergenic
1084934000 11:72577331-72577353 CACCTCCCACAGCCCTCCACTGG - Exonic
1085313759 11:75531252-75531274 CGCCCCCCAGAGCTCTACCGAGG - Intergenic
1085402919 11:76245283-76245305 CCCCTCCCAGAGCTGTGGTGAGG + Intergenic
1086944427 11:92831105-92831127 CCCATCTCACAGCTCACCAGTGG + Intronic
1089386360 11:118070821-118070843 TCCTTCCCAGAGGTCCCCAGTGG + Intergenic
1089494076 11:118899732-118899754 CCCAGCCCAGAGCACTCGAGTGG - Intronic
1089571994 11:119417219-119417241 GCCAGCCCAGAGCTCTCCAAGGG - Intergenic
1089625497 11:119748417-119748439 CCCCAGACACAGCTCTCCAGAGG - Intergenic
1089794675 11:120970632-120970654 CCCTTCCCAGAGCTTGCCAATGG - Intronic
1091390110 12:121044-121066 CCCTTCCCAGAGCACTGGAGGGG - Intronic
1092167691 12:6352967-6352989 CTCCTCCCAGGGCTCTCCCCTGG - Intronic
1092257871 12:6937034-6937056 CCCTTCCCAGGGCCCTCAAGGGG + Exonic
1092401192 12:8180490-8180512 GCCCTCCCAGAGCCCCGCAGAGG + Intronic
1092418862 12:8313408-8313430 CACCTCCCAGAGGTCCCCAGTGG - Intergenic
1094544202 12:31389223-31389245 CCCCTTCCAGAGCTCTCCTTTGG - Intronic
1096215854 12:49797061-49797083 CCCCTCCCAGACCCCCCAAGAGG + Exonic
1096216139 12:49798397-49798419 CCCCTCCCTGAGCTCCACTGAGG - Exonic
1098644374 12:72880319-72880341 CCCCACACAGAGTTCTCCAAGGG - Intergenic
1101825420 12:108216708-108216730 CATCCTCCAGAGCTCTCCAGTGG - Intronic
1103404620 12:120666664-120666686 AACCTCCCACAGCTCTCCACTGG - Intronic
1104548302 12:129732330-129732352 CCCATCCTAAAGCTCTCCTGGGG - Intronic
1104753500 12:131254617-131254639 CACCTCCCAGAGCACTGCAGAGG - Intergenic
1104992485 12:132633985-132634007 CCCCTCTCCGGGCCCTCCAGTGG + Intronic
1107018672 13:35730018-35730040 CCCCTCCCAGAGCTGGCCAGTGG + Intergenic
1112441153 13:99426052-99426074 CCCCTCCCAGGGCTCTGGGGTGG - Intergenic
1113631823 13:111893476-111893498 TCCCTCCCACAGCCCTCCAGCGG - Intergenic
1113739818 13:112703745-112703767 CCCCTACCAGCTTTCTCCAGTGG - Intronic
1113926211 13:113943081-113943103 GCTCTCCCCGAGCTCTCCTGTGG - Intergenic
1114792226 14:25672389-25672411 CCCTACCCAGAGCACTCCCGGGG - Intergenic
1118697665 14:68400337-68400359 CCCTTCCCAGCTCTCTCCAAAGG + Intronic
1119223368 14:72926600-72926622 TCCCACCCCGAGCTCTGCAGCGG - Intronic
1119437386 14:74606258-74606280 AACCTCCCACAGCTCTCCACTGG + Intronic
1120840759 14:89083039-89083061 CCCCTCCCAGAGCCTGCCACAGG - Intergenic
1120996614 14:90422640-90422662 CCCCCCCCCCAACTCTCCAGAGG - Intergenic
1121779903 14:96615677-96615699 CTCATCCCAGAGATCTCAAGGGG - Intergenic
1122307773 14:100776578-100776600 CTCCTCCCAGAACCCACCAGAGG - Intergenic
1122631898 14:103111161-103111183 CCCCTCCCAGCCCTCCACAGTGG + Intergenic
1124189794 15:27564816-27564838 CCCCTCTCAGTGCTCTCCTCTGG + Intergenic
1124232504 15:27957419-27957441 ACCCTCACTGAGCTCTGCAGGGG - Intronic
1124371826 15:29108423-29108445 CCCCTCCCTGGGCCCTGCAGTGG - Intronic
1124899453 15:33808842-33808864 CCCCTCCCACTGCTGTCCAAGGG + Intronic
1125874848 15:43134477-43134499 CACCTCACAGAGCTCACCTGGGG - Intronic
1128575715 15:68773394-68773416 CCCCTGCCAAAACTCTGCAGTGG - Intergenic
1128727524 15:69999030-69999052 CTCCTGCCAGCGCTCTCCATAGG + Intergenic
1129424442 15:75454048-75454070 CCCCTCCCAGCTCTCTCCGCCGG + Intronic
1129614234 15:77085069-77085091 CCCCTCCCAGGGCTTTGGAGGGG - Intergenic
1130014338 15:80175369-80175391 CCCCTCCCCAGCCTCTCCAGGGG + Intronic
1130896594 15:88174804-88174826 CCCTGCTCAGAGCCCTCCAGCGG + Intronic
1131559920 15:93430695-93430717 CTCCTCCCAGGGCAATCCAGGGG + Intergenic
1131972257 15:97904353-97904375 CCGCTCCCAGAGCCCGGCAGTGG + Intergenic
1132645601 16:997951-997973 CCCATCTGAGAGCTCGCCAGAGG + Intergenic
1132728614 16:1349724-1349746 CCACACCCAAACCTCTCCAGTGG + Intronic
1132772487 16:1571922-1571944 GGCCCCCCAGAGCTCCCCAGTGG - Intronic
1132835660 16:1951701-1951723 CACCTCCCAGAACTCTGCTGAGG - Intronic
1132995067 16:2818451-2818473 CACCTCCCAGAGCTGTCCCAAGG - Intronic
1133284959 16:4686443-4686465 CCGAATCCAGAGCTCTCCAGTGG + Intronic
1133358312 16:5153373-5153395 CACCTCCCCGAGGTCCCCAGTGG - Intergenic
1133573981 16:7069733-7069755 CATCTCCCAGAGCTCTACAATGG + Intronic
1134260841 16:12649697-12649719 CCCCTTCCAGCGAACTCCAGTGG + Intergenic
1135384555 16:22025724-22025746 CCCCTACAACAGCTCTGCAGGGG + Intronic
1135796138 16:25444685-25444707 CATCTCCCAGAGGTCCCCAGAGG + Intergenic
1136779552 16:32887632-32887654 CGGCTCCCAGAGCTCTCTGGCGG - Intergenic
1136891064 16:33973886-33973908 CGGCTCCCAGAGCTCTCTGGCGG + Intergenic
1137555246 16:49466228-49466250 CCCCTCCCCGAGACATCCAGGGG - Intergenic
1138321204 16:56113596-56113618 CCCATCCCAGAGTGGTCCAGTGG - Intergenic
1141769908 16:86083519-86083541 CCACTCCCAGAGCTCTCTGGGGG + Intergenic
1141821793 16:86451196-86451218 GTCCCCCCAGAGCTTTCCAGTGG + Intergenic
1142008966 16:87704234-87704256 CCCTCCCCAGGGCTCTCCACAGG - Intronic
1142115229 16:88352910-88352932 CACCTCCCAGGCCTCTCCAACGG - Intergenic
1142131455 16:88433329-88433351 CCCCGCCCAGGGCTCCCCAGGGG + Exonic
1142149407 16:88506074-88506096 CCCCACCCTGGGCTCTCCACTGG + Intronic
1142210714 16:88807157-88807179 CCTCTCCCAGTGCTCTGAAGGGG + Exonic
1142396003 16:89831980-89832002 CCACGTCCAGAGCTCTGCAGAGG + Intronic
1203081968 16_KI270728v1_random:1149720-1149742 CGGCTCCCAGAGCTCTCTGGCGG - Intergenic
1142718874 17:1763143-1763165 CCCCTCCCCTGGCTCTCCGGAGG - Intronic
1143381365 17:6498331-6498353 CTCCTCCCAGAGCTAGCCTGGGG + Intronic
1143514254 17:7411508-7411530 ACCTTCCCATAGCCCTCCAGTGG + Intronic
1144286821 17:13785295-13785317 GGCCTCCCAGAGTTCTCCAGTGG + Intergenic
1147327012 17:39674503-39674525 CTCCTCCCAGTGCTCCTCAGAGG + Intronic
1147382079 17:40062169-40062191 CCCCTCCCCGAGCTCAGGAGAGG + Intronic
1147743942 17:42683763-42683785 CCCCTCCCAGACCCTTCCAAAGG - Intronic
1147760423 17:42794647-42794669 CCCCTCCCAGACCCATCCAATGG + Exonic
1148475977 17:47928986-47929008 CCCCTCTCCGAGCTCTCCAAGGG - Intergenic
1148996456 17:51714477-51714499 CACCTCCCAAAGAGCTCCAGAGG - Intronic
1149296073 17:55263988-55264010 CCCCCCGCGGAGCTCTGCAGGGG + Intergenic
1149994315 17:61399068-61399090 CCCCGCCCTGAGCTTTCCAGCGG - Intergenic
1151578685 17:74965337-74965359 CCTCACCCAGAGCCCTTCAGGGG + Intronic
1151757358 17:76082453-76082475 CTCCCCACAGAGCCCTCCAGAGG + Exonic
1154054596 18:11000794-11000816 CTGCTCCCAGAACTCTCCATAGG - Intronic
1155106719 18:22674376-22674398 CCCCTGACAGAGCTTTTCAGAGG - Intergenic
1157133832 18:45034816-45034838 CCCTTCCCAGAGCACACCCGTGG + Intronic
1157549286 18:48570153-48570175 CCACTCCCAGAGCTGTGGAGAGG + Intronic
1157701264 18:49762698-49762720 CCTCTCCCAGAGCCCACCCGAGG - Intergenic
1159031753 18:63238953-63238975 GCCATCCCACAGCTCTCCAGGGG - Intronic
1160218808 18:76957411-76957433 CCTCTCCCAGGTCCCTCCAGGGG + Intronic
1160417538 18:78721499-78721521 TCCCTGCCAGAGCTCACCAGGGG + Intergenic
1160890233 19:1373853-1373875 CTCCTCCCTGGCCTCTCCAGGGG - Intronic
1160955803 19:1691264-1691286 CCCCTCCCAGAGCCCTGGAGTGG + Intergenic
1161237399 19:3204776-3204798 CCCCTCCTAGGGCTTTCCTGGGG + Intronic
1161295850 19:3519881-3519903 CCACACCCACAGCTCTCCTGGGG + Intronic
1161377226 19:3946200-3946222 CCCCTCCCAGAGCCATCTAAGGG + Intergenic
1162917775 19:13883443-13883465 GGACTACCAGAGCTCTCCAGTGG + Intronic
1163110013 19:15154158-15154180 TGCCACCCAGAGGTCTCCAGTGG - Intergenic
1163196256 19:15723266-15723288 CCCATCCCTGAGCTTTCCTGAGG + Intergenic
1163325189 19:16599030-16599052 GCCCTCCAGGAGCTGTCCAGTGG - Intronic
1163359565 19:16837245-16837267 CGCCTCCCAGAACCATCCAGTGG - Intronic
1164438232 19:28250989-28251011 CACCTCCCAGAGGTCCCCAGTGG - Intergenic
1164506672 19:28866864-28866886 GCCCTCCCAGAGTTCCCCACGGG - Intergenic
1164725147 19:30461139-30461161 GCCCTCCCAGAGATTCCCAGAGG + Intronic
1164826226 19:31286797-31286819 CCCCACCCTCAGCTCACCAGTGG + Intronic
1165434105 19:35787392-35787414 CCACTCCCTGAGGTCCCCAGGGG - Exonic
1166561617 19:43736417-43736439 CACCTCCCAGCGGTCTCCTGGGG + Intronic
1166970384 19:46563173-46563195 CACCCCCCAGAGCCCTCAAGAGG - Intronic
1167311152 19:48738826-48738848 CCCCTCCCAGTCCCCTCCCGCGG + Intronic
1167349295 19:48964752-48964774 CATCTTCCAGAGATCTCCAGGGG + Intergenic
1168115697 19:54220450-54220472 CCCAGCCGAGAGCTCTCCTGGGG + Intronic
1168118684 19:54240196-54240218 CCCAGCCGAGAGCTCTCCTGGGG + Intronic
1168121506 19:54254658-54254680 CCCAGCCCAGAGCTCTCCTGGGG + Intronic
1168125014 19:54278182-54278204 CCCAGCCCAGAGCTCTCCTGGGG + Intronic
1168133035 19:54332803-54332825 CTCTGCCCAGAGCTCTCCTGGGG + Intergenic
1168176968 19:54633372-54633394 CCCAGCCCAGAGCTCTCCTGGGG - Intronic
1168678203 19:58294376-58294398 CCATTCCCAGAGATCTCTAGAGG + Exonic
925168837 2:1738385-1738407 CCCCTCCCAGAGCACTGATGTGG + Intronic
925371398 2:3348325-3348347 GCACTCCCAGAGGTCTCCAGAGG + Intronic
925833231 2:7917052-7917074 ACACTCCCAGAGCTCACCATGGG - Intergenic
925979710 2:9166905-9166927 CTCCTCCCAGAGCTTCCCACTGG + Intergenic
927148767 2:20183965-20183987 GTCCTCCCAGACCTCTCCTGTGG - Intergenic
927664359 2:25019679-25019701 GCCCTGGCAGAGTTCTCCAGTGG - Intergenic
930771911 2:55137832-55137854 GCCAGCCCAGAGCACTCCAGCGG + Intergenic
932593158 2:73079274-73079296 CCCCACCCACAGCTCCCCTGCGG + Intronic
932849052 2:75165640-75165662 CCCCTCCCAGACTACTCCAGTGG - Intronic
933633489 2:84682266-84682288 CCCCTCCCCGCCTTCTCCAGTGG + Intronic
934773260 2:96921398-96921420 CCCCACCCAGGGCACTCTAGGGG + Intronic
934852003 2:97707482-97707504 GCCCTCCCAGAGCTCTCCACTGG + Intergenic
934853390 2:97714982-97715004 TCCCTCCCAGGGCTCTCGGGAGG + Intronic
935191078 2:100779349-100779371 CACCTTCTATAGCTCTCCAGTGG - Intergenic
935800597 2:106691430-106691452 TTACTCCCAGAGCTCCCCAGCGG - Intergenic
936263405 2:110980964-110980986 CCCCTCCCCCAGCACACCAGGGG + Intronic
936781876 2:116042938-116042960 CTCCTTTCAGAGATCTCCAGTGG + Intergenic
937341469 2:121093804-121093826 CTCCTGACAGATCTCTCCAGAGG + Intergenic
937659496 2:124414301-124414323 CCCCTCCCCAAGTTCACCAGTGG - Intronic
937907135 2:127057914-127057936 CCCCTCCCACAGTTGGCCAGTGG - Intronic
938224614 2:129605135-129605157 CCCCACCCAGCTCTCTCCTGTGG + Intergenic
941484051 2:166056786-166056808 CACCTCCCAGAGAACTTCAGTGG + Intronic
943582250 2:189698755-189698777 CTCCTGCCAGAGCTATCCATTGG + Intronic
944995327 2:205287543-205287565 GCTGTCCCAGAGCTCACCAGGGG + Intronic
947859856 2:233350999-233351021 GCCCTTCCTGAGATCTCCAGGGG + Intergenic
948180049 2:235972624-235972646 TCCCTCCCACTGGTCTCCAGTGG + Intronic
948248807 2:236508413-236508435 ACCCTCCCAAAGCCCTTCAGGGG + Intergenic
948588545 2:239035856-239035878 CCCCTCCCACAGCTGGCCTGGGG - Intergenic
1168770185 20:409397-409419 CCCCTCCCAGAGGCCTCCCCTGG + Intronic
1169855155 20:10094092-10094114 CAGCTTCCAGAGTTCTCCAGTGG - Intergenic
1169959531 20:11143602-11143624 CGTCTCTCAGAGCTCCCCAGAGG + Intergenic
1171265169 20:23765912-23765934 CCCATTGCAGAGCTCTCCATGGG + Intergenic
1171277413 20:23869807-23869829 CCCGTTGCAGAGCTCTCCATGGG + Intergenic
1171282352 20:23911357-23911379 CCCATTACAGAGCTCTCCATGGG + Intergenic
1172114417 20:32565095-32565117 CCCCTCACAGAGCTGTCCTGAGG + Intronic
1172153670 20:32808649-32808671 CCCCTTCCTGAGCTCCCCAGAGG - Exonic
1173100352 20:40082163-40082185 CCCATCCCGAAGCTCTCTAGAGG - Intergenic
1173554200 20:43954055-43954077 CCCCTGCAAGAACTCTCCAAGGG + Intronic
1174364618 20:50048956-50048978 CCCCTCCCCGCCCCCTCCAGAGG + Intergenic
1174442722 20:50568880-50568902 CCGCTCCCACAGCTCCGCAGAGG - Intronic
1174699901 20:52597677-52597699 CCCCTCCCAGAGCTTTAGAAGGG - Intergenic
1175793510 20:61757236-61757258 CCCCCCCCAGCCCCCTCCAGGGG + Intronic
1175816014 20:61883618-61883640 CACGTGCCTGAGCTCTCCAGTGG - Intronic
1176100992 20:63364511-63364533 CCACAACCAGCGCTCTCCAGCGG - Intronic
1176171351 20:63697739-63697761 ACTTTCCCAGAGCTCCCCAGGGG - Intronic
1176203966 20:63878116-63878138 CACTGCCCAGAGCTCTGCAGGGG + Intronic
1178937944 21:36880823-36880845 CCCCTCCCAGAGCACTCCTTAGG + Intronic
1179414491 21:41187152-41187174 CACCTCTCAGAGTTCCCCAGTGG - Intronic
1179496805 21:41776884-41776906 CCACTCCCAGACAACTCCAGGGG - Intergenic
1179558418 21:42195245-42195267 CCCCACCCCCAGCTCTCCTGAGG - Intergenic
1179710551 21:43210755-43210777 CCTCTCCCAGACCTGGCCAGGGG - Intergenic
1179995855 21:44973698-44973720 CCCCACCCCGCCCTCTCCAGGGG + Intronic
1180164056 21:46011329-46011351 CCCTTCCCATAGGTCTCCTGGGG + Intergenic
1180230085 21:46421924-46421946 TCCCACCCACAGCTCTCCAGGGG - Intronic
1180955422 22:19739211-19739233 ACCCACCCAGGTCTCTCCAGAGG + Intergenic
1181062856 22:20290296-20290318 CCTGTCCCAGAGCCCTTCAGGGG - Intergenic
1181487916 22:23243219-23243241 CCCGTCCCACAGCTATCTAGGGG - Intronic
1182666914 22:31966810-31966832 CCCCTCCCAGAGCTCCTGTGGGG - Intergenic
1183191886 22:36326833-36326855 CACTTCCCATGGCTCTCCAGGGG + Intronic
1183265756 22:36824159-36824181 CCCATCCCAGTGCTGCCCAGAGG + Intergenic
1183516630 22:38270642-38270664 CCCCACACAGAGCTCTCCCAGGG + Intronic
1183669189 22:39262399-39262421 CCCTGCTCAGAGCCCTCCAGTGG + Intergenic
1183751620 22:39724177-39724199 CCCAGCCCAGAGCCCTCCCGAGG - Intergenic
1183785465 22:40026730-40026752 CCCTTTCCAGAACTCTCCTGGGG + Intronic
1184173464 22:42772743-42772765 CCCCACCAAGGCCTCTCCAGGGG - Intergenic
1184742897 22:46439395-46439417 CACCTCACAGTGCTCTCCTGGGG + Exonic
1184774972 22:46618581-46618603 CCCCTGCCAAAGTTCTCCAGGGG - Intronic
1185158785 22:49210055-49210077 CCCCTCCCCCACCCCTCCAGGGG - Intergenic
1185189527 22:49425634-49425656 CCCCACCCACAGCCCTCCAAGGG - Intronic
1185318612 22:50190053-50190075 CACACCCTAGAGCTCTCCAGGGG + Intronic
949976791 3:9468039-9468061 GCCCTCCCAGTGCTATCCAGGGG - Intronic
950425161 3:12921166-12921188 CCCCTCCACGAGGTCACCAGTGG - Intronic
950462860 3:13135607-13135629 GCAGCCCCAGAGCTCTCCAGTGG + Intergenic
950731808 3:14966272-14966294 GCTCTCCCAGAGCTCTCTAACGG + Intronic
953610841 3:44446079-44446101 CCCCAGCCAGAACTCCCCAGGGG + Exonic
953682906 3:45052811-45052833 TGCCTCCCAGACATCTCCAGGGG - Intergenic
955742150 3:62102708-62102730 GACCTCTCAGACCTCTCCAGGGG - Intronic
955818632 3:62874203-62874225 GGGCTCCCAGCGCTCTCCAGCGG - Intronic
956687514 3:71843913-71843935 CATCTCCCAGAGGTCCCCAGTGG - Intergenic
956755100 3:72378021-72378043 CCCCTCCCAGCCCTCCCCACCGG + Exonic
956841524 3:73144364-73144386 CCCCTCTCAGACCACTCCAGAGG + Intergenic
956929413 3:74025666-74025688 CTCCTACCAGAGCCCTCCTGAGG - Intergenic
957062829 3:75495961-75495983 CACCTCCCAGAGGTCCCCAGTGG - Intergenic
961290572 3:125843455-125843477 CACTTCCCAGAGGTCCCCAGTGG + Intergenic
961606361 3:128098485-128098507 CACTTCCCAGAGCTCCACAGGGG - Intronic
961701925 3:128751180-128751202 CCCCACACAGAGCTCTCCACAGG + Intronic
961896544 3:130172630-130172652 CACCTCCCAGAGGTCCCCAGTGG - Intergenic
967949726 3:194831597-194831619 CCCTTCCCCGAGCTCTTCACAGG - Intergenic
968448315 4:663520-663542 CCCCTCCCTGCGCTCCCCGGTGG + Intronic
968460282 4:721403-721425 CTCCTGGCAGAGCTCCCCAGAGG + Intronic
968556105 4:1247307-1247329 TCCCTCCCAGAGCTCTGCAGAGG + Intronic
968593816 4:1472454-1472476 CACCTCCCGGATCTCCCCAGAGG + Intergenic
968648884 4:1752661-1752683 GCCCTCCCCGGGATCTCCAGAGG - Intergenic
968977748 4:3830749-3830771 CTCCACCCAGAGCTCCCCATGGG - Intergenic
969114445 4:4862332-4862354 CTCCTCCCAGGGCCATCCAGAGG - Intronic
969778916 4:9381090-9381112 GCCCTCCCAGAGCCCCGCAGAGG - Intergenic
969806252 4:9611324-9611346 CACCTCCCAGAGGTCCCCAGTGG + Intergenic
969862933 4:10051954-10051976 CCCTTCCTAAAGCCCTCCAGTGG + Intronic
976356722 4:84127204-84127226 CCCCTCCCCCAGCCCTCCTGGGG - Intergenic
976524925 4:86075980-86076002 CCCCTCCCCCAGCCCTCCTGGGG + Intronic
980150110 4:129035704-129035726 CTCCTCTCATAGCTTTCCAGAGG - Intronic
980167131 4:129242466-129242488 GCCCTTCCAGATCTCTCCAAAGG - Intergenic
985626482 5:991586-991608 CACCTCCCTGAGCTCACCATGGG - Intergenic
985855214 5:2419001-2419023 CCCCTCCCAGATCTCTCCATTGG - Intergenic
986411887 5:7489077-7489099 CCCTGCCCAGAGCACTCCTGAGG + Intronic
987366538 5:17153700-17153722 TGCCTCCCAGAGTTCCCCAGTGG - Intronic
987994401 5:25256562-25256584 ACCCTCCCACAGTTCACCAGTGG - Intergenic
989166346 5:38436896-38436918 ACTCTCCCAGTGCTCTCCAAGGG + Intronic
990253530 5:53941936-53941958 CCCTTCCCAGAGCCCTGCGGTGG - Intronic
990503631 5:56423060-56423082 TGGCTCCCAGAGCTCCCCAGTGG + Intergenic
995625170 5:114068639-114068661 CCTCTCCCAGTGCTTCCCAGAGG + Intergenic
996771956 5:127095563-127095585 CCTATCCCAGAGCTCCCCTGTGG + Intergenic
996823257 5:127653933-127653955 CCTCCCCTAGGGCTCTCCAGTGG + Intronic
997795238 5:136803223-136803245 CCCTTCTCAAAGCTCACCAGTGG + Intergenic
999214039 5:149916641-149916663 CCATTCCCCTAGCTCTCCAGGGG + Intronic
1001402261 5:171452415-171452437 CCCTTGACAGAGCTTTCCAGAGG + Intronic
1001814866 5:174660077-174660099 CATGTCCCAGAACTCTCCAGAGG - Intergenic
1002116859 5:176969036-176969058 CCCCTCCCAGTACTTTCCTGTGG + Exonic
1002188449 5:177466880-177466902 GCCCGCCCGGAGCGCTCCAGGGG - Intronic
1002636265 5:180610252-180610274 CCCATCACAGAGCTCAGCAGTGG - Intronic
1002839380 6:892955-892977 CCTGTGCCAGACCTCTCCAGAGG + Intergenic
1002994309 6:2268532-2268554 CCCCCCGCAGTTCTCTCCAGTGG - Intergenic
1003040733 6:2685256-2685278 CCCCTCCCTGACCTCCCCAAGGG - Intronic
1005307747 6:24530269-24530291 CCCATCCCTGATATCTCCAGTGG + Intronic
1006510484 6:34518633-34518655 CCCCTCCCAGAGCTCTCCAGCGG - Intronic
1006897502 6:37480294-37480316 GCCCTGCCTGAGCTCTTCAGGGG - Exonic
1007139149 6:39554309-39554331 CCCATCCCAGAAGTCCCCAGTGG + Intronic
1007376492 6:41460317-41460339 CCCCTCCCAGGGCTCTGAGGAGG + Intergenic
1007585134 6:42984743-42984765 CCCCTCCCAGAGCTCCGCGCAGG - Intronic
1008251498 6:49245380-49245402 CTCCTCCAACAGCACTCCAGTGG - Intergenic
1012249347 6:96962440-96962462 CCCGTCTCCAAGCTCTCCAGAGG - Intronic
1014260924 6:119216101-119216123 CCCCTGCATCAGCTCTCCAGAGG - Intronic
1018369637 6:163156032-163156054 CCCTTCGCAGCGCTCTCCTGAGG + Intronic
1019288472 7:235575-235597 CCCCTCCCTGAGCCCTGCCGAGG + Intronic
1019436546 7:1025192-1025214 CTCCCCGCAGAGCTCTGCAGAGG + Intronic
1019851262 7:3560667-3560689 CCCTTCTCAGCACTCTCCAGTGG + Intronic
1020327232 7:6984240-6984262 CACCTCCCAGAGGTCCCCAGTGG - Intergenic
1022911797 7:34905859-34905881 AACCTCCCAGAGCTCCCCATGGG - Intergenic
1024531294 7:50394592-50394614 CTCCTCCCAGAGCTATTCTGAGG + Intronic
1024671684 7:51601290-51601312 CCACTTCCAGAGCTCTCTGGGGG + Intergenic
1025215577 7:57053266-57053288 CCCCTCCCAGGTCCTTCCAGGGG + Intergenic
1025655800 7:63517435-63517457 CCCCTCCCAGGTCCTTCCAGGGG - Intergenic
1025947485 7:66115406-66115428 CTCTTCCGAGGGCTCTCCAGGGG - Intronic
1026787932 7:73313450-73313472 CCACTCCTGGAGCTCTCCAAGGG - Exonic
1028986891 7:97016524-97016546 CCCCTCCCCAAGCTCTGGAGCGG + Intergenic
1029480474 7:100809426-100809448 CTCCTGCCAAAGCCCTCCAGCGG + Intronic
1029506473 7:100966440-100966462 CCCCGACCAGCGCCCTCCAGTGG - Exonic
1029516147 7:101024528-101024550 CACCTCCCATGGCCCTCCAGTGG + Intronic
1029903589 7:104068208-104068230 CTCCTCCTGGAGCTCCCCAGTGG + Intergenic
1030230513 7:107203976-107203998 CTACTCCCAGAGCTCACGAGGGG + Intronic
1033099927 7:138460930-138460952 CCTCTCCCCGGGCTCCCCAGCGG - Intronic
1033725390 7:144110478-144110500 CCCTCCACAGAGCACTCCAGAGG + Exonic
1034864522 7:154629700-154629722 CCCATTCCAGAGGACTCCAGTGG + Intronic
1035487222 7:159235584-159235606 CCCCTCCCACACCTGTCCTGCGG + Intergenic
1035795902 8:2356080-2356102 GCCGTCCCAGAGCACACCAGAGG - Intergenic
1036026374 8:4913529-4913551 GCCCTCAAAGAGCTCTACAGGGG + Intronic
1036276361 8:7355051-7355073 GCCCTCCCAGAGCCCCGCAGAGG - Intergenic
1036296722 8:7543488-7543510 GCCCTCCCAGAGCCGTGCAGAGG + Intergenic
1036325845 8:7777531-7777553 GCCCTCCCAGAGCCGTGCAGAGG - Intergenic
1036344983 8:7955296-7955318 GCCCTCCCAGAGCCCCGCAGAGG + Intergenic
1036369388 8:8149816-8149838 CACCTCTCAGAGGTCCCCAGTGG + Intergenic
1036753922 8:11460147-11460169 CCCCTCCCAGAGCCCTGTAGTGG - Intronic
1036881501 8:12515824-12515846 CACCTCTCAGAGGTCCCCAGTGG - Intergenic
1038138147 8:24813148-24813170 CCCCTTCCAGAGCTTGTCAGAGG + Intergenic
1038349431 8:26762776-26762798 CCCATCTCAGAGCTCTGCTGTGG + Intronic
1038933442 8:32220740-32220762 CCCCTCCCGGAGCTCCTCCGCGG + Intronic
1039920619 8:41891728-41891750 CGCCTCCCAGAGCTCCAGAGAGG + Intronic
1041015593 8:53590461-53590483 CCTCTGCCAGCTCTCTCCAGAGG - Intergenic
1041814313 8:61950604-61950626 CCACACCAATAGCTCTCCAGTGG + Intergenic
1042236110 8:66614166-66614188 CCCCTCCCTGGTCTCTCCAGAGG - Intronic
1042844057 8:73152737-73152759 CTCCTCACAGAGCTGTCCAGAGG + Intergenic
1046619192 8:116509716-116509738 CCTCTCGCAGCCCTCTCCAGTGG - Intergenic
1046945505 8:119970879-119970901 CCCCTCCGAGGGCTCCCCGGTGG - Intronic
1048209383 8:132442351-132442373 CCCCTTGCTAAGCTCTCCAGAGG - Intronic
1049354658 8:142181830-142181852 CCCGTCCCAGAGCTCTCGGAGGG + Intergenic
1049383163 8:142327545-142327567 CCCCTCACAGAGCCCTCCATCGG + Intronic
1051298225 9:15618963-15618985 CCCCTCCCCGCCCTGTCCAGTGG + Intronic
1051569740 9:18542276-18542298 CACCTCCCAGAGTTCTGCTGAGG + Intronic
1051908705 9:22127623-22127645 CCCCGCCCAGAGATCCTCAGTGG - Intergenic
1054713732 9:68537131-68537153 CCCCTCCCCAAGCTCTCTTGTGG + Exonic
1056436968 9:86583872-86583894 CCACTCCCAGATATCTCCATGGG + Intergenic
1057950132 9:99363314-99363336 CCCCTCCCACAGCTGTCAAAAGG - Intergenic
1058413786 9:104764127-104764149 CCCCTGCCTGAGTTCGCCAGTGG + Intergenic
1058625609 9:106929973-106929995 CTCCTCCCATGGCTCCCCAGGGG + Intronic
1061892607 9:133630691-133630713 CCCCTCCCAGAGCCCCCAAAAGG - Intergenic
1062107400 9:134763439-134763461 CACATGCCACAGCTCTCCAGAGG - Intronic
1062459267 9:136656036-136656058 GCCCCCCCAGAGCCCCCCAGAGG - Intergenic
1062495663 9:136830428-136830450 CCCCACCGAGGGCTCTCCTGAGG - Intronic
1062500060 9:136848446-136848468 CCGCGCCCAGAGCTCTCTGGAGG + Exonic
1187543971 X:20229128-20229150 CCCCTCACAGAGCAGTCCATAGG + Intronic
1188003328 X:25001991-25002013 CTCCTCCCCAAACTCTCCAGCGG + Intergenic
1189185279 X:39049505-39049527 TCTCTCCCAGAGGTGTCCAGTGG + Intergenic
1189429035 X:40931007-40931029 TTTCTCACAGAGCTCTCCAGTGG - Intergenic
1189548899 X:42072674-42072696 TGTCTCCCAGAGATCTCCAGTGG - Intergenic
1189772418 X:44439407-44439429 CCCTTCCCCCAGCTCCCCAGAGG - Intergenic
1190114170 X:47614873-47614895 CCAGTGCCAGAGCTCCCCAGAGG + Intronic
1190371084 X:49741419-49741441 CCCCTTCCAGATCTCTCAGGTGG - Intergenic
1190737861 X:53267407-53267429 CCCCTACAACAGCTCTGCAGAGG + Intronic
1193168589 X:78310141-78310163 TCCCTCTCAGAGGTCTCCAGTGG + Intronic
1195094610 X:101492149-101492171 CCCAGCCCAGAGCCCTCCACTGG - Exonic
1197143960 X:123149863-123149885 TCCTTCCCAAAGCTATCCAGGGG + Intergenic
1198394414 X:136207704-136207726 CCCCTCCCCAGGCCCTCCAGAGG - Intronic
1198398887 X:136251120-136251142 CCCATCCCAGGGCACTCCGGCGG + Intronic
1199928481 X:152494359-152494381 CCCCTCCCAGATGTTTCCACGGG - Intergenic