ID: 1006510487

View in Genome Browser
Species Human (GRCh38)
Location 6:34518665-34518687
Sequence CACCTTTGACTCAGTCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006510484_1006510487 9 Left 1006510484 6:34518633-34518655 CCGCTGGAGAGCTCTGGGAGGGG 0: 1
1: 0
2: 4
3: 46
4: 351
Right 1006510487 6:34518665-34518687 CACCTTTGACTCAGTCCAGGAGG No data
1006510482_1006510487 10 Left 1006510482 6:34518632-34518654 CCCGCTGGAGAGCTCTGGGAGGG 0: 1
1: 0
2: 3
3: 54
4: 397
Right 1006510487 6:34518665-34518687 CACCTTTGACTCAGTCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006510487 Original CRISPR CACCTTTGACTCAGTCCAGG AGG Intronic
No off target data available for this crispr