ID: 1006510712

View in Genome Browser
Species Human (GRCh38)
Location 6:34519647-34519669
Sequence CTCTGGGCCTTCTGTGCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 1, 2: 6, 3: 56, 4: 295}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006510705_1006510712 27 Left 1006510705 6:34519597-34519619 CCTGTCATGAAGGCTCTGTAGCT 0: 1
1: 0
2: 0
3: 11
4: 119
Right 1006510712 6:34519647-34519669 CTCTGGGCCTTCTGTGCACTGGG 0: 1
1: 1
2: 6
3: 56
4: 295
1006510707_1006510712 -3 Left 1006510707 6:34519627-34519649 CCCATAATACTGCAGGTGAACTC 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1006510712 6:34519647-34519669 CTCTGGGCCTTCTGTGCACTGGG 0: 1
1: 1
2: 6
3: 56
4: 295
1006510708_1006510712 -4 Left 1006510708 6:34519628-34519650 CCATAATACTGCAGGTGAACTCT 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1006510712 6:34519647-34519669 CTCTGGGCCTTCTGTGCACTGGG 0: 1
1: 1
2: 6
3: 56
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006510712 Original CRISPR CTCTGGGCCTTCTGTGCACT GGG Intronic
900540954 1:3202406-3202428 CTGTGGGGCCCCTGTGCACTGGG + Intronic
900689713 1:3973321-3973343 CTCAGGGGCTCCTGTGCACAGGG + Intergenic
901683327 1:10929070-10929092 CTCTGGCCCTTCTGTGTTCAGGG + Intergenic
902397799 1:16141944-16141966 CTCTGGGACCCCTGAGCACTTGG - Intronic
902796360 1:18803227-18803249 CTCCATGCCTTCTGTGCCCTGGG - Intergenic
903273484 1:22206694-22206716 CTCTGTGCTTTCAGTTCACTGGG - Intergenic
903745823 1:25586002-25586024 CTCTGGGCCATCTGTAAAATGGG - Intergenic
904605116 1:31693928-31693950 CTGAGGCCCTTCTGTGCACCAGG - Intronic
905631391 1:39520998-39521020 CTCTGGGTCTCCTGTGAAGTAGG + Intronic
905666363 1:39765173-39765195 CTCTGGGTCTCCTGTGAAGTAGG - Intronic
905793630 1:40803171-40803193 CTCAGGGACTTCTGTGTTCTGGG - Intronic
908380456 1:63593242-63593264 CTCTAGGCCTCCTGTGAAATGGG - Intronic
909112663 1:71499343-71499365 ATCTTTGCCTTCTCTGCACTAGG - Intronic
913956507 1:143302233-143302255 CTCTGGGTCTTCTCTGCCCTCGG + Intergenic
913980934 1:143513434-143513456 CTTTGGGTCTTCTCTGCGCTCGG - Intergenic
914075298 1:144339862-144339884 CTCTGGGTCTTCTCTGCCCTCGG - Intergenic
914103880 1:144626634-144626656 CTCTGGGTCTTCTCTGCCCTCGG + Intergenic
914891406 1:151627005-151627027 ATCTGGGCATTCTGGGCATTAGG + Intronic
915463979 1:156085229-156085251 CCCTGGGCCTCCTCTGCACCTGG - Intronic
915914477 1:159932617-159932639 CAGTGAGCCTTCTGTGCCCTGGG + Exonic
915931269 1:160062232-160062254 CTCTGGGCCCTCCGGACACTGGG + Intronic
916731290 1:167569257-167569279 CTCTCTGCCTTCTGGGCACAAGG + Intergenic
917736651 1:177927227-177927249 GTCAGGGGTTTCTGTGCACTAGG - Intronic
919880293 1:201896600-201896622 CCCTGTGCCTGCTGGGCACTGGG - Exonic
920395834 1:205645287-205645309 CTGTGGTCCTTATGTTCACTGGG - Intergenic
921266831 1:213427957-213427979 CTCATGGCCTTCTGTGCTGTGGG + Intergenic
921743499 1:218712250-218712272 CTCTGGGCCTGCTGTGTCCTGGG + Intergenic
1062767944 10:79892-79914 CCCTGGGCTTTCTGGGCTCTAGG - Intergenic
1063612053 10:7570942-7570964 CCCTCTGCCTTCTGTGCACATGG + Intronic
1063852349 10:10207345-10207367 CTCAGGGCCTTCTGTGCACCAGG + Intergenic
1064126112 10:12662188-12662210 CTTTGGGCCATCTGTGTACTTGG - Intronic
1064613533 10:17128591-17128613 CTCCGTGCCTTCTCTGGACTAGG + Intronic
1066781670 10:38955028-38955050 CTCTGGGCCTTCTGTGCCCTTGG - Intergenic
1067714036 10:48672707-48672729 CTCTGGGCTGTCTGTGGAATGGG - Intergenic
1068174951 10:53446398-53446420 CACATGGCCCTCTGTGCACTAGG - Intergenic
1069893466 10:71666236-71666258 CTCTGGGCCTTCTGAGCATGTGG - Intronic
1071105789 10:82092954-82092976 TTCTGGGCCTTCATTGCACATGG - Intronic
1073006756 10:100330515-100330537 CTCTGGGCCATCTCTCCACCAGG - Intergenic
1073022950 10:100462044-100462066 CTCTGCTCCTTCTGTTCCCTAGG - Intergenic
1074458490 10:113615618-113615640 CTCAGGGGCTTCTGAGCACAGGG + Intronic
1074682010 10:115916780-115916802 CTCAGGGCCTTCTGTTTACTGGG + Intronic
1074693575 10:116028361-116028383 CTGTGGGCCTGCTGTCCACAGGG - Intergenic
1074898422 10:117796389-117796411 CTCCGGGCCTCCTGAGCAATGGG + Intergenic
1076193881 10:128501161-128501183 TTCTGGGCCTTGTGGGCACAGGG - Intergenic
1076586653 10:131553291-131553313 CTCCGGGCTTCCTGTGGACTTGG - Intergenic
1076623779 10:131809314-131809336 CCCTGGGTCTCCTGGGCACTGGG - Intergenic
1077081852 11:727891-727913 CTTTGGGCCTTCTGGTCGCTGGG - Intergenic
1079704351 11:23595411-23595433 CCCTGGGCCCTCTGAGCATTAGG + Intergenic
1080316732 11:30958336-30958358 CTTTGGGCATCCTGTCCACTTGG - Intronic
1080453133 11:32395301-32395323 CTCTGGGCCTTGTGGGCACTAGG - Intronic
1083297274 11:61721740-61721762 CTCTTGTGCTTCTGTGCACTGGG + Intronic
1083655071 11:64225654-64225676 CTCTGGGCTCTCTCTGCAGTGGG - Intronic
1083685048 11:64370684-64370706 CTCTGGGCCCGCAGTGCGCTCGG + Exonic
1083782164 11:64924322-64924344 GCCTGGGCCTTCTATGCCCTAGG - Intronic
1084320375 11:68370206-68370228 AGCTGGGCCTTCTGAGCCCTGGG + Intronic
1085230549 11:74965451-74965473 CTCTCACCCTTCTGTGCTCTAGG - Intronic
1085282212 11:75338537-75338559 CTCAGGTCTTTCTGTACACTGGG + Intronic
1085531297 11:77193764-77193786 CACTGGGGCTGCTGTGCACCAGG + Intronic
1085737118 11:79048707-79048729 CTCTGGGCCTTTTCTGTACCCGG + Intronic
1085762623 11:79255276-79255298 CACAGGTCCTTCTGTGCACTGGG - Intronic
1086400580 11:86458192-86458214 TTCTGGGCCTTCTCTGGGCTAGG + Intronic
1086567924 11:88248037-88248059 CTCTCTGCCTTCTGAGCACATGG - Intergenic
1089374689 11:117986189-117986211 CTCTGGGCCTCCAGTGCCTTCGG - Intergenic
1089443581 11:118534422-118534444 CTCTCTGCCTCCTGGGCACTTGG - Intronic
1089615282 11:119691587-119691609 CTTTCAGCCTTCTGGGCACTGGG - Intronic
1090359635 11:126163468-126163490 CGCTGGGCATTCTGTGCCCTGGG - Intergenic
1090472603 11:126993663-126993685 CTGTGGGCCTCCTATGCAGTAGG - Intronic
1090492647 11:127178381-127178403 TTCTTGGCCTTCTGTGTGCTGGG - Intergenic
1091722554 12:2823968-2823990 CTGTGGGTCTCCTGGGCACTCGG - Intronic
1092563052 12:9636861-9636883 CTCTGACCGTCCTGTGCACTGGG - Intergenic
1092989845 12:13886080-13886102 CTCTGAGACTTGTGTGTACTTGG - Intronic
1093602317 12:21043075-21043097 TTCTGGAGCTTGTGTGCACTTGG - Intronic
1093713966 12:22360507-22360529 ATCTGTGCCTGCTGTGCACTGGG - Intronic
1097895840 12:64824498-64824520 CTCTGGCGCTTCTGGGCACGGGG + Intronic
1099355407 12:81628887-81628909 CTATAGGCCTTATGTGCAATTGG - Intronic
1101951570 12:109180108-109180130 CCCTGGGACTTCTCTGCCCTGGG + Intronic
1102507955 12:113395773-113395795 ATTTGGGCCTTCTGTGTAATGGG + Intronic
1102561258 12:113763930-113763952 CTCTGGCCCTCCTGTGACCTTGG - Intergenic
1103617892 12:122166601-122166623 CTCAGGGCCCTCTGAGCTCTGGG + Intergenic
1104492937 12:129210032-129210054 CTCTGTGCCATCTGTAAACTGGG - Intronic
1104751633 12:131243862-131243884 GTCTGGGCCTTGTGTGCACATGG - Intergenic
1104780259 12:131415213-131415235 GTCTGGGCCTTGTGTGCACATGG + Intergenic
1107430869 13:40338964-40338986 CTCTGGGAATTCTGCCCACTGGG - Intergenic
1109040842 13:57334172-57334194 CTCTGTTGCATCTGTGCACTGGG - Intergenic
1109686770 13:65830635-65830657 CTCTGTGCCTGGTGTGCCCTTGG + Intergenic
1110722991 13:78786589-78786611 CTCTGGGCCTTTCCTGCACAGGG + Intergenic
1112712059 13:102140339-102140361 CTCAGTGCTTTCTGTGTACTAGG + Intronic
1115306249 14:31936745-31936767 CACTGAGCTTTCTGTGCTCTGGG + Intergenic
1117947338 14:61042347-61042369 TTCTTGTCCTTTTGTGCACTGGG + Intronic
1118374814 14:65167477-65167499 CTCTGCTGCTCCTGTGCACTGGG + Intergenic
1120325719 14:83023147-83023169 CTCTGGGGCTTGTGAGCACAAGG + Intergenic
1122235923 14:100330591-100330613 CTCTCGGCCTTCTGGGCTGTGGG + Intergenic
1122331418 14:100918055-100918077 CACTGGAGCTACTGTGCACTTGG + Intergenic
1202938921 14_KI270725v1_random:123909-123931 CTCTGGGTCTTCTCTGCCCTAGG + Intergenic
1123394217 15:19912368-19912390 CTCTGGGTCTTCTCTGCCCTAGG - Intergenic
1123439805 15:20282084-20282106 TGGTGGGGCTTCTGTGCACTTGG + Intergenic
1124185646 15:27526145-27526167 CTCTGGGCCTTCTCAGCATTTGG - Intronic
1125789529 15:42353297-42353319 CTCTGTGCCTTCTGATCCCTGGG + Exonic
1125890021 15:43258835-43258857 CTCAGGGCCTTCTGAGCAGTGGG - Intronic
1126958015 15:53956417-53956439 CTCTGAGCCTTCTGAGCAGCTGG - Intergenic
1127886508 15:63206292-63206314 CTCAGGGCCTTCTCTGCCCCAGG - Intronic
1128261873 15:66238263-66238285 CTCTGGGGCATCTGTGGACTGGG - Intronic
1128588671 15:68875147-68875169 TTCAGGGCCTTCTGTGCACCAGG - Intronic
1129286670 15:74531019-74531041 CTCTGGGACTACTGAGCGCTGGG + Intergenic
1129887151 15:79046631-79046653 CTCTGGGCCTCATCTGCACTCGG + Intronic
1130866784 15:87940171-87940193 CTCAGTGACTTCTGTGCCCTTGG + Intronic
1130881052 15:88056481-88056503 CTCGGGGCCTTCGTTTCACTTGG + Intronic
1132726543 16:1341353-1341375 CGCTGCTCCTTCTGTGCACGGGG - Exonic
1132937328 16:2487814-2487836 GTCTGGGACTTCAGGGCACTCGG - Intronic
1132954356 16:2583620-2583642 CACTGGGTCCTCCGTGCACTGGG + Intronic
1132959989 16:2616543-2616565 CACTGGGTCCTCCGTGCACTGGG - Intergenic
1134081368 16:11327269-11327291 CTCCGGGCCTTCTGTGGGGTGGG + Intronic
1136537760 16:30910463-30910485 CTCTGGGGCTTCTGCACACGAGG - Intergenic
1136700236 16:32130257-32130279 CTCTGGGTCTTCTCTGCCCTAGG - Intergenic
1136767413 16:32797207-32797229 CTCTGGGTCGTCTCTGCCCTAGG + Intergenic
1136800735 16:33073494-33073516 CTCTGGGTCGTCTCTGCCCTAGG - Intergenic
1136845361 16:33572313-33572335 TGGTGGGGCTTCTGTGCACTTGG - Intergenic
1136863674 16:33722373-33722395 CTCTGGGTCTTCTCTGCCCTAGG + Intergenic
1136868867 16:33783418-33783440 CTCTGGGTCTTCTCTGCCCTAGG - Intergenic
1136958635 16:34817211-34817233 CTCTGGGTCTTCTCTGCCCTAGG - Intergenic
1137979212 16:53055392-53055414 CTCTGGACCTTATCAGCACTCGG - Intronic
1140060327 16:71564017-71564039 CTCTGAGCCATTTGTGGACTAGG + Intronic
1140074863 16:71689128-71689150 CTGTGGGCCTCCTGGGCTCTGGG - Intronic
1140210971 16:72969952-72969974 CTCTGGGCCTTCTGGGCAGTGGG - Intronic
1141838663 16:86559968-86559990 CTTTGGGCCTGCTGTGCCCCGGG - Intergenic
1203069807 16_KI270728v1_random:1059229-1059251 CTCTGGGTCATCTCTGCCCTAGG + Intergenic
1203103307 16_KI270728v1_random:1332650-1332672 CTCTGGGTCTTCTCTGCCCTAGG + Intergenic
1203107069 16_KI270728v1_random:1420966-1420988 TGGTGGGGCTTCTGTGCACTTGG - Intergenic
1203125158 16_KI270728v1_random:1570519-1570541 CTCTGGGTCTTCTCTGCCCTAGG + Intergenic
1203155529 16_KI270728v1_random:1872611-1872633 TGGTGGGGCTTCTGTGCACTTGG - Intergenic
1142962117 17:3557578-3557600 CTCTGGGCCATGTCTGCCCTTGG - Intronic
1143275093 17:5704409-5704431 CACTGGGCTTTCTCTGCACCAGG + Intergenic
1144336174 17:14270794-14270816 CTCTGTGCCTCCTCTGCCCTAGG + Intergenic
1144772448 17:17767236-17767258 TTCTGGGCCTGCTGTGGCCTAGG - Intronic
1145218507 17:21069958-21069980 CTGTGGGCGGTCTGTGCCCTTGG - Intergenic
1145324510 17:21791618-21791640 CTCTGGGTCTTCTGTGCCCTAGG + Intergenic
1145326095 17:21827191-21827213 CTCTGGGTCTTCTCTGCCCTGGG - Intergenic
1145689151 17:26716675-26716697 CTCTGGATCTTCTCTGCCCTAGG - Intergenic
1145710925 17:26975466-26975488 CTCTGGGTCTTCTGTGCCCTAGG - Intergenic
1147461323 17:40571685-40571707 CTTTGGGACTTCTTTGCCCTTGG - Intergenic
1148221307 17:45864346-45864368 CTCTGGGCCTTCGTTACTCTTGG - Intergenic
1148240733 17:45998045-45998067 TGCTGGGCCTTCTGGGCACTGGG + Intronic
1148496929 17:48058599-48058621 CTCTGGGCCTGCTGTGTCATTGG - Exonic
1148659824 17:49320831-49320853 CTCTCGGCTTTCTGGGCACATGG + Intronic
1149954824 17:61036943-61036965 CTCTGGACCTTCTGCTCATTTGG - Intronic
1151651537 17:75473204-75473226 CTCTGGACCAGCTGTGCAATAGG + Intronic
1151759617 17:76093196-76093218 CTCTGTGCCTTCTGTGTGGTGGG - Intronic
1151823732 17:76512150-76512172 CCCTGGGCTTTCTGTTCCCTGGG + Intergenic
1152527799 17:80899164-80899186 CTCTGCGCTTTCTGGGCACTTGG - Intronic
1152566172 17:81101349-81101371 CTCTGGGCCTTGCCTGCTCTGGG - Intronic
1152904318 17:82961926-82961948 CTCTGGGCCTTGTGTGGAGCCGG + Intronic
1203182341 17_KI270729v1_random:72329-72351 CTCTGGATCTTCTCTGCTCTAGG - Intergenic
1203190288 17_KI270729v1_random:177824-177846 CTCTGGATCTTCTCTGCCCTAGG - Intergenic
1153253174 18:3142687-3142709 CTCTGGGACTTCTGGGATCTGGG - Intronic
1153678796 18:7480507-7480529 CTCTGGGCCTCCTGTGCTGCTGG - Intergenic
1154516902 18:15179991-15180013 CTCTGGGTCTTCTCTGCCCTAGG + Intergenic
1155262033 18:24052352-24052374 CACTGGGCCGGCTGTGTACTTGG + Intronic
1156079298 18:33314964-33314986 CTCTGGGGATTCGGTGCCCTAGG - Intronic
1156120600 18:33838164-33838186 CTCTGAGCCTTCTGTCAACAGGG + Intergenic
1156866260 18:41891981-41892003 TTCTGAGTCTTGTGTGCACTGGG + Intergenic
1157099663 18:44717750-44717772 CTCAGGTCCTTCAGTGCTCTGGG - Intronic
1157287730 18:46388619-46388641 CTCTGTGACTTCTTTTCACTCGG + Intronic
1158272826 18:55734926-55734948 TTCAGGGCCTTAGGTGCACTGGG - Intergenic
1158955692 18:62535654-62535676 CCCTGGGCCTCCTGGACACTTGG - Intronic
1159985395 18:74835352-74835374 CACTGGGCCTTCTGTGCAAGTGG - Intronic
1160188761 18:76697303-76697325 CTGAGGGACTCCTGTGCACTGGG + Intergenic
1160231880 18:77054925-77054947 CTCTGGGCTTTCTGTGCCAAAGG - Intronic
1160984742 19:1833417-1833439 CTCTGCGCCTGCTGGGCACATGG - Intronic
1161223989 19:3133882-3133904 CTCTGGGACTTCAGGGCCCTAGG - Intergenic
1163170084 19:15525242-15525264 CTGGGAACCTTCTGTGCACTAGG + Intronic
1164934226 19:32198571-32198593 CTCTGGGCAACCTGTGCCCTAGG - Intergenic
1165326138 19:35115567-35115589 CTGGGGGCCTTATGTGGACTAGG + Intergenic
1165725169 19:38107543-38107565 CTCTGGGGCTTCTGTTCATTAGG - Intronic
1165798661 19:38534447-38534469 CTCCAGGCCATCTGTGAACTTGG - Intronic
1166377516 19:42336021-42336043 GTGTGGGCCTTCAGTCCACTGGG + Exonic
1167236516 19:48319073-48319095 CTCTGGGTCTTCTGGGACCTGGG + Intronic
1167300393 19:48674324-48674346 CGCAGGTCCTTCTGTGCTCTAGG + Intergenic
925367630 2:3321847-3321869 GTCTGTGCCTTCTGTTCACTGGG - Intronic
925641190 2:5987117-5987139 CTCTGGTCCTACCTTGCACTTGG + Intergenic
926220355 2:10932062-10932084 GTCTGTGCCTTCTGTGCATGTGG + Intergenic
926813095 2:16773836-16773858 TTCTTGGACTTCTGTGCACAGGG - Intergenic
927573055 2:24176463-24176485 GCCTGGGCCTTCAGAGCACTAGG + Intronic
927679234 2:25129248-25129270 ACCTGGGCTATCTGTGCACTAGG + Intronic
929344131 2:40859906-40859928 CTCTGGGGCTGCTATGCCCTAGG - Intergenic
929450093 2:42030994-42031016 CTCTGGGTCTGCTGGGCACTGGG - Intergenic
930007397 2:46909104-46909126 CTCTGGGCCTTTTGTGCCCCAGG - Exonic
932323575 2:70839288-70839310 CTCTAGTCCTGCTGTGCACTAGG + Intergenic
932916545 2:75865285-75865307 CTCTGTGCCCCCTGTGCCCTGGG - Intergenic
933811785 2:86037198-86037220 CTCTGTGCTATCTGGGCACTGGG - Intronic
933975768 2:87508164-87508186 CCCTGGGACTTCGGTGTACTGGG + Intergenic
934252775 2:90375652-90375674 CTCTGGATCTTCTCTGCCCTAGG + Intergenic
934256666 2:91427295-91427317 CTCTGGATCTTCTCTGCCCTAGG - Intergenic
934576451 2:95404710-95404732 CTGAGAGCCTTCTGTGCACCAGG + Intronic
934794972 2:97092526-97092548 CTGAGAGCCTTCTGTGCACCAGG - Intronic
936318057 2:111442649-111442671 CCCTGGGACTTCGGTGTACTGGG - Intergenic
937706789 2:124930253-124930275 TTCTGGGCTTTCAGTGCACTTGG + Intergenic
938517230 2:132024960-132024982 CTCTGGGTTTTCTCTGCCCTAGG + Intergenic
939699201 2:145368945-145368967 CTCTGGGCCTTCTTTGATTTTGG - Intergenic
942734849 2:179097612-179097634 CCTTGTGCCTTCTGTGCCCTGGG - Intergenic
944348415 2:198697515-198697537 CTGAGGGCCTTCTGTGCATGAGG + Intergenic
945809782 2:214534698-214534720 TTCTGGTTCTTCTGTGCTCTAGG + Intronic
946291409 2:218748246-218748268 CTCTAGGCCTTCACTGGACTGGG - Intronic
947383460 2:229567354-229567376 CTGAGTGCCTACTGTGCACTAGG - Intronic
947482133 2:230510390-230510412 CTCTGGGCCCTGTGGTCACTGGG + Intronic
948922128 2:241070770-241070792 CACTGCTCCTTCTGTGAACTTGG - Intronic
1171501842 20:25599915-25599937 CTCTGGGTGTTCTGTACAGTGGG - Intergenic
1173579187 20:44134992-44135014 CTCTTGGTATTCTGTCCACTTGG - Intronic
1173769903 20:45647480-45647502 CACTGGGCCTTGGGTGCACATGG + Intergenic
1173955800 20:47031620-47031642 CTCTGGGCCTTCATTCCTCTGGG - Intronic
1175214264 20:57382650-57382672 CTCTGGGACATCACTGCACTAGG + Intergenic
1175857528 20:62130421-62130443 CTCTGTTCCTTCTGTGGCCTTGG + Intronic
1175980085 20:62734327-62734349 CTCTTGGGCTTCGGTGCAGTAGG + Intronic
1176584334 21:8563620-8563642 CTCTGGGTCTTCTTTGCCCTAGG - Intergenic
1177305207 21:19306569-19306591 CTCTGACCCACCTGTGCACTGGG + Intergenic
1177944144 21:27446210-27446232 CTCTGTACAGTCTGTGCACTGGG - Intergenic
1179345715 21:40554977-40554999 CTGAATGCCTTCTGTGCACTAGG - Intronic
1179451664 21:41472512-41472534 CTCTGGGCCCTCTAGGAACTGGG - Intronic
1179621309 21:42618011-42618033 ATCTGGGCTTTCTCTGCACCTGG - Intergenic
1179905450 21:44420412-44420434 CTCAGTGCCTTCTAGGCACTGGG - Intronic
1180267146 22:10540524-10540546 CTCTGGGTCTTCTTTGCCCTAGG - Intergenic
1180365282 22:11933025-11933047 GACTGGGCCTTCTGTGGACCTGG + Intergenic
1180883206 22:19221274-19221296 ATCAGGGCTTTCTGTGCACCTGG - Intronic
1180975989 22:19848756-19848778 CTTTGGGGCTTTTGTGCCCTTGG - Exonic
1182359563 22:29738589-29738611 CTCCAGGCCATCTGTGCACGAGG + Intronic
1182713938 22:32340310-32340332 CTAGGTGCCTTCTGTGCACAAGG + Intergenic
1182737824 22:32543619-32543641 TTCTGGGCCTTCTAAGCCCTTGG + Intronic
1183354229 22:37349873-37349895 TTTTGGGCCTTCTGTGCCCAGGG - Intergenic
1183735294 22:39641674-39641696 CTGTGTGCATTATGTGCACTGGG - Intronic
1184287085 22:43477847-43477869 CTCTGGTCTTTCTGTGTAGTGGG + Intronic
1184289368 22:43490206-43490228 GTCTGGTCCTTCTATGCATTTGG + Intronic
1184401249 22:44275894-44275916 CTAGGTGCCTTCTGTGCACAAGG + Intronic
1184696305 22:46140991-46141013 TGGTGGGGCTTCTGTGCACTTGG + Intergenic
1185119313 22:48956300-48956322 ATCTGGGCCTTCTGGGAGCTGGG - Intergenic
1185136684 22:49077443-49077465 CTTTGGACCTTCTGTGGACAGGG + Intergenic
1185203928 22:49525928-49525950 CTCTGGGCACACTGTGCACTTGG - Intronic
1203288285 22_KI270735v1_random:5223-5245 CTCTGTGTCTTCTGTGCACTAGG + Intergenic
1203326111 22_KI270738v1_random:21129-21151 CTCTGGATCTTCTCTGCCCTAGG + Intergenic
949782725 3:7708383-7708405 CTCTGTGCTTTCTGTGCAACCGG - Intronic
950138755 3:10601063-10601085 CTGTGAGCCTACTGTGCACCAGG + Intronic
950179926 3:10904297-10904319 CTCTGTACCTACTGTGCACCAGG + Intronic
950612923 3:14137554-14137576 CTCTGGGCCTTTTTTCTACTTGG - Intronic
950763226 3:15253428-15253450 TTCTGGGAATTCTGTTCACTGGG - Intergenic
952102470 3:30030659-30030681 CTCTGGGCCTTTTTCTCACTGGG + Intergenic
952344597 3:32471844-32471866 CTTTGGGCACTCTGTGCAATGGG + Intronic
952411386 3:33052967-33052989 TCCTGCGCCTTCTCTGCACTAGG - Intronic
952966359 3:38623472-38623494 CTCTGGGCCTCCTGTAGGCTGGG + Intronic
954527494 3:51284885-51284907 CTCTTGGCTTTCTGTGATCTAGG - Intronic
954961581 3:54570117-54570139 TTTTGTGCCTTCTTTGCACTTGG + Intronic
956217207 3:66860856-66860878 CTCTGGTCCTTCTGGCCAGTGGG - Intergenic
958743797 3:98109372-98109394 CTCTGAGCAGTCTGTGCATTGGG + Intergenic
959427855 3:106215264-106215286 CTCAGGGCCTGCTGTGGCCTTGG + Intergenic
960882545 3:122360089-122360111 GTCAAGGCCTTCTGTGCATTTGG - Intronic
962196511 3:133368155-133368177 CTCTGGGGATTCAGTGCACTGGG + Intronic
966960571 3:184933806-184933828 CTCTGGGCCTTCTGTTCCATTGG + Intronic
967149765 3:186637774-186637796 CTCTGGACGTCCTGTGCACCAGG + Intronic
967327283 3:188254062-188254084 CTCAGGGCCATCTGTGCACATGG + Intronic
967743124 3:193024777-193024799 CTCTGGGCCTTCCCTGCAATGGG - Intergenic
967775177 3:193378782-193378804 CCCTTGGGCTTCTGTGAACTTGG + Exonic
968694466 4:2016216-2016238 CTCTGGGCTTTCTGTAGAGTAGG + Intronic
969231945 4:5838265-5838287 CCCTGGGCCTCCTCTGCCCTTGG - Intronic
969719456 4:8885274-8885296 CTTTGGGTCTTCTGTGGAGTTGG - Intergenic
970193975 4:13538789-13538811 CTCTCGGCCTTCTCTGGGCTTGG - Intergenic
972873510 4:43329581-43329603 CTCTGAGCCTGCTGTACAGTGGG - Intergenic
973893184 4:55388072-55388094 TTCTGTGCCTTCTTTGCCCTTGG - Intergenic
975756701 4:77578502-77578524 CTCTGAGCCACCTGTGCACTGGG + Intronic
976804659 4:89033372-89033394 CTCTGTGCCTTTTGTGAAGTGGG - Intronic
978534434 4:109746025-109746047 CTCAGGGCCTTCTGAGCATGGGG + Intronic
982018236 4:151176955-151176977 CACTGAGGCTTCTGTCCACTAGG - Exonic
984186185 4:176546435-176546457 CTCTGGGACCTCTGTGTTCTGGG + Intergenic
987582990 5:19820253-19820275 CTCTGGGTGTTCTGGGCTCTAGG - Intronic
990106964 5:52276650-52276672 CTTTGGGCTTTGTGTCCACTTGG + Intergenic
991188809 5:63844044-63844066 CTTTTGGCCTTCTGTGTACCTGG + Intergenic
991393472 5:66176252-66176274 TTCTGGGTCTTCTGTGCCCTTGG + Intronic
994795994 5:104300316-104300338 CTCTGAGCATTCTGAGCATTGGG - Intergenic
995672663 5:114624651-114624673 CACTGTGCCTTCAGTGCTCTGGG - Intergenic
997151072 5:131495834-131495856 CTCTGTTACTTCTGTGCACAGGG - Intronic
998365607 5:141628819-141628841 CTCTGAGCCAACTGTGTACTAGG + Intronic
999013504 5:148070009-148070031 CTATTGGCCTACTGTGTACTAGG + Intronic
999053879 5:148552971-148552993 CTCTGGGCCTTCTTTTCTCTAGG - Intronic
999306607 5:150523663-150523685 CTGTGGGAGCTCTGTGCACTGGG - Intronic
1001569000 5:172718050-172718072 CTCTGAGGCTTCTGGGCACAGGG - Intergenic
1002346784 5:178553672-178553694 CTCGAGGCCTTCTGGGCACGTGG + Intronic
1002457482 5:179353877-179353899 CTCTGGGCCCGCTGTGCCATGGG + Intergenic
1003015110 6:2462018-2462040 CTCAGGTCCTGCTGTGCCCTGGG + Intergenic
1004098706 6:12586002-12586024 CACTGGGCATCCTTTGCACTCGG + Intergenic
1004254794 6:14053066-14053088 TACTGGGCCTTCTGTGCAATCGG + Intergenic
1005671710 6:28112891-28112913 CTCTGGGCCTGCTGGGCTCCTGG - Intergenic
1005926871 6:30451902-30451924 CCCGGGGCGTTCTGTGGACTGGG + Intergenic
1005928604 6:30464600-30464622 CCCGGGGCGTTCTGTGAACTGGG + Intergenic
1006290331 6:33130455-33130477 TTCTGGGCCTTGTGTGCCCCTGG + Intergenic
1006510712 6:34519647-34519669 CTCTGGGCCTTCTGTGCACTGGG + Intronic
1007393650 6:41564913-41564935 CTTTGGACCTTCTGTGGCCTGGG + Intronic
1007932823 6:45707852-45707874 CTGTGTGCCTTCTGTACCCTGGG - Intergenic
1009521203 6:64683920-64683942 CTCTGGGCTTACTGTGAAATGGG - Intronic
1013038896 6:106414225-106414247 ATCTTGACCTTCTGTGCACCTGG + Intergenic
1013547900 6:111177644-111177666 CTTTGTGCCTTATGTTCACTTGG + Exonic
1013914798 6:115323130-115323152 ACCTGGGCTTTCTCTGCACTTGG + Intergenic
1014915525 6:127142897-127142919 GCCTGGGCCTTCTGTGCTCAAGG + Intronic
1017926811 6:158917800-158917822 CTCTTAGCCATCTGAGCACTGGG + Intergenic
1018142224 6:160849917-160849939 CTCTGGGCTATCTGTTCTCTAGG - Intergenic
1018616375 6:165690651-165690673 CTGAGAGCATTCTGTGCACTGGG - Intronic
1018635234 6:165854694-165854716 CTCTGGGGCTTCTGCGGGCTCGG - Intronic
1019181296 6:170188680-170188702 CACAGGCTCTTCTGTGCACTGGG + Intergenic
1019498937 7:1354881-1354903 CTCTGGGCCATTCGTGCAATGGG - Intergenic
1020138372 7:5598989-5599011 CCCTGCGGCTTCTGTGCAGTGGG + Intronic
1021237133 7:18155964-18155986 CTCTGGGGGTTCTGGGGACTGGG - Intronic
1022028520 7:26470366-26470388 CTCTGGTCTTTCAGTGCTCTTGG + Intergenic
1024572371 7:50733881-50733903 CTCAAGGCCTTCTGTGGATTGGG - Intronic
1024807521 7:53162440-53162462 CTCCGGGTCTTCTCTGCCCTAGG + Intergenic
1025306321 7:57861866-57861888 CTCTGGGTCTTCTCTGCCCTAGG + Intergenic
1025319037 7:58071773-58071795 CTCTGGATCTTCTCTGCCCTAGG - Intergenic
1025477449 7:60942253-60942275 CTCTGGATCTTCTCTGCCCTAGG - Intergenic
1025482876 7:61006507-61006529 CTCTGGGTCGTCTCTGCCCTAGG - Intergenic
1025554681 7:62291411-62291433 CTCTGGATCTTCTCTGCCCTAGG + Intergenic
1025560100 7:62361865-62361887 CTCTGGATCTTCTCTGCCCTAGG - Intergenic
1025562960 7:62393436-62393458 CTCTGGGTCTTCTCTGCCCTAGG - Intergenic
1025564187 7:62410861-62410883 CTCTGGGTCTTCTCTGCCCTAGG - Intergenic
1025877348 7:65495201-65495223 CTCTGGGTCTTCTCTGCCCTAGG + Intergenic
1026930186 7:74219539-74219561 CTCTGGCCCCTCCGTGCACTGGG - Intronic
1030442475 7:109604495-109604517 CCCTGGGCCTTCTGCTCGCTTGG + Intergenic
1031861047 7:126980910-126980932 CTCTCAACCTTCTCTGCACTAGG + Intronic
1032850554 7:135791572-135791594 CCCTGGGACTTCTGTGCACAAGG - Intergenic
1033291165 7:140084044-140084066 CTTTGGTCCTTCTGGTCACTTGG + Intergenic
1034202266 7:149290005-149290027 CTCTGGCCCCTCTCCGCACTGGG - Intronic
1034539290 7:151745891-151745913 CTCTTGGCCTGGTGTGCTCTTGG - Intronic
1034971546 7:155422807-155422829 CTCAGGGCCTTTCCTGCACTAGG + Intergenic
1035469338 7:159099773-159099795 CTCAGGGGCTTCTGTGGCCTGGG - Intronic
1037430839 8:18811683-18811705 CTTTGGGCCTTCTCTGGGCTTGG - Intronic
1037905836 8:22715638-22715660 CTCTGAGCCTTCAGTGCCCTGGG + Intronic
1038318946 8:26511405-26511427 CTCTGGGGCTCCTGGGCACAGGG - Intronic
1039440115 8:37589101-37589123 CTGTGGGCCATCTGGGCCCTGGG - Intergenic
1042051593 8:64715419-64715441 CTTTTGGGCTTCTGTTCACTTGG + Intronic
1046561960 8:115849074-115849096 CTGTGTGCCTTCTGAGCACCAGG + Intergenic
1048806892 8:138249507-138249529 CTGGGGGCCTGCTGTGCTCTAGG - Intronic
1048961990 8:139587692-139587714 CTCTGGGTCTTCTGCCTACTGGG + Intergenic
1049742999 8:144249942-144249964 CTCTGGGCCACATGTGCCCTTGG + Intronic
1053276677 9:36788416-36788438 CTCTGGGCTTTCTCTGGTCTGGG + Intergenic
1055867309 9:80830623-80830645 CTGTGGGCCTACTTTGTACTGGG - Intergenic
1055936029 9:81605006-81605028 CTCTCAGCCTTCTCTGCCCTTGG - Intronic
1057422578 9:94924257-94924279 CTGAGGGCCTACTATGCACTAGG + Intronic
1057615328 9:96584461-96584483 CTCTGTGCCTTCTCTTCTCTGGG - Intronic
1058739785 9:107931232-107931254 CCCTGGGCCTTCTGGGTAATGGG + Intergenic
1058902633 9:109455775-109455797 CTCTGGGCTGTCTGCACACTTGG + Intronic
1059412277 9:114139850-114139872 CTCTGGGGCTTCTGTAGACCTGG - Intergenic
1060281795 9:122220031-122220053 GGCTGAGCCTTCTGTGCGCTTGG + Intronic
1061476333 9:130869371-130869393 CTCTTGGCACTCTGTGCACAAGG + Intronic
1062451264 9:136616740-136616762 ATCTGGGCCATTGGTGCACTTGG + Intergenic
1062538784 9:137032378-137032400 ACCTGGGCCTTCTCTGCCCTGGG - Exonic
1062579988 9:137225185-137225207 CTCTCGGTCTTCTGAGCTCTAGG - Exonic
1203614239 Un_KI270749v1:41150-41172 CTCTGGGTCTTCTCTGCCCTAGG - Intergenic
1185673337 X:1828758-1828780 CTCTCGGCCTTCAGTCCACCTGG + Intergenic
1185673444 X:1829706-1829728 CTCTCGGCCTTCAGTCCACCTGG + Intergenic
1187608846 X:20917861-20917883 TTCTGTGACTTCTTTGCACTCGG - Intergenic
1188525496 X:31083602-31083624 CTCTTTCCCTTCTGTGCAGTTGG - Intergenic
1190127708 X:47721604-47721626 CTGTGGGCCTCCAGTGCACATGG - Intergenic
1190543212 X:51498863-51498885 CTCTGGTCCTCCTGTCCTCTTGG + Intergenic
1192735053 X:73842903-73842925 CTCTGCCCCTTGTGTGCCCTTGG - Intergenic
1196948802 X:120855150-120855172 CCCTGGGCCTAATGAGCACTAGG - Intergenic
1197733412 X:129831481-129831503 CTCGGGTCCTTCTGTGCAGCGGG - Intronic