ID: 1006515558

View in Genome Browser
Species Human (GRCh38)
Location 6:34543892-34543914
Sequence TCCCCAAAGCTGCCCGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 173}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006515554_1006515558 15 Left 1006515554 6:34543854-34543876 CCCAGGCTCACAGCTGACTGTGT 0: 1
1: 0
2: 0
3: 20
4: 198
Right 1006515558 6:34543892-34543914 TCCCCAAAGCTGCCCGAGGCTGG 0: 1
1: 0
2: 0
3: 24
4: 173
1006515553_1006515558 20 Left 1006515553 6:34543849-34543871 CCTGGCCCAGGCTCACAGCTGAC 0: 1
1: 0
2: 4
3: 54
4: 493
Right 1006515558 6:34543892-34543914 TCCCCAAAGCTGCCCGAGGCTGG 0: 1
1: 0
2: 0
3: 24
4: 173
1006515555_1006515558 14 Left 1006515555 6:34543855-34543877 CCAGGCTCACAGCTGACTGTGTG 0: 1
1: 0
2: 0
3: 24
4: 283
Right 1006515558 6:34543892-34543914 TCCCCAAAGCTGCCCGAGGCTGG 0: 1
1: 0
2: 0
3: 24
4: 173
1006515552_1006515558 24 Left 1006515552 6:34543845-34543867 CCTTCCTGGCCCAGGCTCACAGC 0: 1
1: 0
2: 4
3: 86
4: 516
Right 1006515558 6:34543892-34543914 TCCCCAAAGCTGCCCGAGGCTGG 0: 1
1: 0
2: 0
3: 24
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006515558 Original CRISPR TCCCCAAAGCTGCCCGAGGC TGG Intronic
900326955 1:2113058-2113080 TGCCCACTGCTGGCCGAGGCTGG + Intronic
900647847 1:3717159-3717181 TGCCCAAACCTGCCCGTGCCGGG + Intronic
901204292 1:7485047-7485069 TCCCCAGAGCTGCCCGGACCTGG + Intronic
902556827 1:17251838-17251860 TCCCCAAACCTGCCATATGCAGG + Intronic
902874746 1:19334042-19334064 TCCCCAGGGCTGTCCCAGGCTGG - Intergenic
903187805 1:21639177-21639199 TGCCCTGAGCTGCCCCAGGCTGG + Intronic
904365889 1:30010667-30010689 TCCCCAAGGTTGCCCCACGCCGG - Intergenic
904889759 1:33771010-33771032 TCCCCCAAGCTGAAAGAGGCAGG - Intronic
909981463 1:82106733-82106755 TCACCAAAGCTGACTGGGGCAGG - Intergenic
912927993 1:113929983-113930005 TCCCCTCAGCTCCCTGAGGCGGG + Intronic
915891320 1:159776729-159776751 TTCCCAAAGCTTCCCATGGCAGG + Intergenic
916002902 1:160633645-160633667 TCCCTGAACCTGCCTGAGGCAGG + Intronic
916496901 1:165355241-165355263 TCCCCAAAGCCGCGAGGGGCGGG - Intronic
916500526 1:165383307-165383329 TCACCAAGGCTGGCCGAGCCAGG - Intergenic
916732501 1:167579296-167579318 TCCCCACAGCTTTCCGAGGCAGG + Intergenic
916950907 1:169779241-169779263 TCCCCAAAGGAGCCTGAGACTGG - Intronic
919895671 1:202008369-202008391 TCCCCCAAGGAGCCTGAGGCAGG - Exonic
920654974 1:207868347-207868369 TGCCCAGAACTGCCCCAGGCCGG - Intergenic
922342397 1:224668582-224668604 CCCCCAAAGCTGGGCTAGGCTGG + Intronic
922809474 1:228407638-228407660 TCCCCAAAGTTGCACGAGCAGGG - Intergenic
1064017442 10:11783538-11783560 TCCCAAAAACAGCCCAAGGCGGG - Intergenic
1064030686 10:11880756-11880778 TCCCCACAGCTTCCCTTGGCCGG + Intergenic
1067222487 10:44353934-44353956 TCCCCATGGCTGCCCATGGCAGG + Intergenic
1067755271 10:49000256-49000278 TCCCATAAGCTGCCCAAGGAAGG + Intergenic
1068479402 10:57570529-57570551 TCCCCCATGTTGCCCCAGGCTGG + Intergenic
1069686266 10:70321001-70321023 TCCCCAAAGCGGCCCCAACCTGG - Intronic
1072895729 10:99365046-99365068 TCCCCAGAGCGGGCTGAGGCAGG - Intronic
1073131100 10:101189756-101189778 CCCCCAAGGCTGGCAGAGGCTGG + Intergenic
1073593243 10:104776308-104776330 TCCCTAAAGCTCCCCAAGGTTGG + Intronic
1073906923 10:108292709-108292731 TCCCCAAAACTGCCCAAGACAGG + Intergenic
1077115513 11:882900-882922 TCCCCACATCTGCGTGAGGCTGG - Intronic
1077116861 11:889117-889139 ACCCCACAGCTGCCAGAGGCCGG + Intronic
1077190397 11:1253655-1253677 TCCCCAAAGCTGGGAGAGGCAGG - Intronic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1084734326 11:71094555-71094577 TACACAAAGCTGCCCGAGCGAGG - Intronic
1089800695 11:121024428-121024450 TCCCCACAGCTGCTCGAGACAGG - Intronic
1091809677 12:3385802-3385824 ACACCAAAGCTGCCAGTGGCTGG - Intronic
1092048738 12:5452740-5452762 TTCCCAAGGCTGCCCTAGGTGGG - Intronic
1092251879 12:6903849-6903871 TCCTCCAAGCTGCCCTGGGCAGG + Intronic
1107432564 13:40352979-40353001 TGCCCACAGCTGCCCCAGCCTGG + Intergenic
1110307693 13:74009047-74009069 TCTCCAAAGCTGGCCGAGGATGG + Intronic
1118326524 14:64785237-64785259 TCCTCAAAGCTGGCCCAGACTGG + Intronic
1118522271 14:66597722-66597744 TCCACAAAGCTGCAAGAGCCAGG - Intronic
1119703944 14:76772647-76772669 TCCCCGCAGCTGCCTGAGCCTGG - Intronic
1122009017 14:98730384-98730406 TCCACATGTCTGCCCGAGGCAGG - Intergenic
1128260879 15:66232107-66232129 TCCACCAAGCTGCCCTCGGCAGG + Intronic
1128741998 15:70090183-70090205 ACCCCAAAGCTGAGCGAGGCAGG + Intronic
1132725336 16:1335951-1335973 TCCCCAGAGCGGCCCGAGAGGGG - Intronic
1133210714 16:4262024-4262046 CCCCCAAAGCTGCCCAACACAGG + Intronic
1133264600 16:4575665-4575687 TCCCCAAGGCTGGCCCAGGGTGG + Exonic
1133394915 16:5439117-5439139 TTCCCAAATCTCCCCAAGGCTGG - Intergenic
1133933738 16:10252481-10252503 TGCCCGAAGCTGCCCTAGCCGGG + Intergenic
1134389594 16:13807197-13807219 TCCCCAAAGCTTTCCCTGGCTGG + Intergenic
1136188005 16:28599449-28599471 TTCCCAAAGCTGGACCAGGCTGG + Intergenic
1136190477 16:28612443-28612465 TTCCCAAAGCTGGACCAGGCTGG + Intronic
1136355761 16:29744243-29744265 TCCCCAGAGATCCCCGAGGCAGG - Exonic
1136541566 16:30930289-30930311 TCGCCAGAGCTGCCCCGGGCTGG - Exonic
1139517894 16:67462526-67462548 GCTCAAAAGCTGGCCGAGGCTGG + Intronic
1139606633 16:68023383-68023405 TCCCCAAGGCTGGCCGGGTCTGG - Exonic
1142396863 16:89837063-89837085 TTTCCAAAGCTGCCCGTGCCTGG + Intronic
1142550132 17:732988-733010 TCCCCACATCTGCCTGCGGCTGG + Intronic
1143355662 17:6326148-6326170 TCCCCAATGCTGCCCAGTGCTGG - Intergenic
1145119723 17:20247052-20247074 TCCCCAAAGCAGCTCTAGTCCGG + Intronic
1146907137 17:36624997-36625019 ACCCCAAAGCTGCTTGAGTCAGG + Intergenic
1147558763 17:41496484-41496506 TCCCCAGAGCTTCCCTTGGCTGG + Intergenic
1147661520 17:42119508-42119530 CCCCCGAAGCTGCCCCTGGCTGG + Intronic
1150585714 17:66516147-66516169 TCCCCAAGGCTGAGGGAGGCGGG + Intronic
1151678089 17:75610178-75610200 GTCCCAAAGCTGCCCGCCGCCGG - Intergenic
1151894723 17:76972298-76972320 GCCCCATACCTGCCCCAGGCTGG + Intergenic
1152409902 17:80117985-80118007 ATCCCACGGCTGCCCGAGGCCGG - Intergenic
1152904559 17:82963135-82963157 CCCCCAAGGCTGCCCGAGGATGG - Intronic
1156407448 18:36796589-36796611 TCCCCATTGCTTCCAGAGGCAGG + Intronic
1156517912 18:37696720-37696742 CCCCTGAAGCTGCCCGGGGCAGG - Intergenic
1160906399 19:1453541-1453563 TCCCCAAAGCTGTCCTTGGAGGG - Exonic
1160927936 19:1555957-1555979 TCGCCCACGCTGCCCGAGCCCGG - Exonic
1161664382 19:5565948-5565970 TTCCCAGAGCTGCCCCAGGCCGG + Intergenic
1163359346 19:16836080-16836102 CGCCAAAGGCTGCCCGAGGCTGG - Intronic
1163489750 19:17610167-17610189 TCTCAAAACCTGCCCAAGGCTGG + Intronic
1163725178 19:18919305-18919327 TCCCCGGAGCCGCCGGAGGCCGG + Exonic
1163816495 19:19468221-19468243 TCCTCAAAGCTGACAGTGGCTGG - Intronic
1164161001 19:22625287-22625309 TCCCCTAAGCAGCCCCAGGAAGG - Intergenic
1165893712 19:39129553-39129575 GCCACAAAGCTGCCCAAAGCAGG - Intronic
1166300613 19:41910197-41910219 TCCCTAAAGATGCCTGAGACTGG - Intronic
1166874137 19:45886896-45886918 TCCCCAAACCTCCCAGAGGGCGG - Intergenic
1167011749 19:46813329-46813351 TCCCCACGGTAGCCCGAGGCTGG - Intergenic
1168086669 19:54052818-54052840 TTCCAAAAGCAGCCAGAGGCCGG + Intronic
925306122 2:2849187-2849209 TCCCCAAAGCTGTCCCACCCAGG + Intergenic
925901299 2:8511155-8511177 TCCCCACAGCTGCAGGGGGCAGG - Intergenic
925903573 2:8525639-8525661 TCCCCTAAGGGGCCCCAGGCTGG + Intergenic
926103054 2:10132903-10132925 TCTCCCATGCTGCCCGAGGAGGG + Intergenic
931369314 2:61647411-61647433 TCCCCAAAGCTGCTGGATGTTGG - Intergenic
932447803 2:71791404-71791426 TCCCCAAAGGGGGCCCAGGCTGG - Intergenic
932579978 2:72986779-72986801 TCACCATAGATGCCCCAGGCTGG - Intronic
932960356 2:76406305-76406327 TTCCCAATGCTGCCCAATGCTGG - Intergenic
937121566 2:119442955-119442977 TCGCCAAAGCTCTCGGAGGCAGG + Intronic
937230916 2:120397663-120397685 TCCCACAAGCTGCCCGTAGCTGG + Intergenic
937815433 2:126245259-126245281 TGCCCAAAGCATCACGAGGCAGG + Intergenic
939960468 2:148561212-148561234 TCCCTAAGGCTGCCCCAGGCCGG + Intergenic
941203956 2:162548292-162548314 TCCCTAAGGCTGCCAGAGGCAGG + Intronic
942004883 2:171687961-171687983 TCCCCAAAGCTGGGCCGGGCGGG - Intronic
946228376 2:218276906-218276928 GCCCCAAAGGTCCCCGGGGCAGG - Intronic
947899177 2:233706195-233706217 TCCACAAAGCTGGCCCAGGCAGG + Intronic
948560672 2:238849150-238849172 CCCGCGAAGCTGCCCGAGCCGGG + Intronic
948663920 2:239523005-239523027 TCCCCGAAGGTGCCAGTGGCTGG - Intergenic
948978313 2:241478331-241478353 GCCCTAAGGCTGCCCCAGGCAGG - Intronic
1172973547 20:38890348-38890370 TGCACAAGGCTGCACGAGGCTGG + Intronic
1174645306 20:52080348-52080370 TCCCCCTAGCTGAACGAGGCAGG + Intronic
1175878041 20:62239533-62239555 ATCCCAAAGCTGCCGGAGCCAGG - Intronic
1175950772 20:62581968-62581990 TTGCCAGAGCTGCCCCAGGCGGG + Intergenic
1176338811 21:5623747-5623769 ACCCAGAAGCTGCCAGAGGCTGG - Intergenic
1176340219 21:5686820-5686842 ACCCAGAAGCTGCCAGAGGCTGG - Intergenic
1176423818 21:6535535-6535557 GCACCACAGCTGCCAGAGGCAGG - Intergenic
1176472473 21:7118973-7118995 ACCCAGAAGCTGCCAGAGGCTGG - Intergenic
1176496034 21:7500751-7500773 ACCCAGAAGCTGCCAGAGGCTGG - Intergenic
1176504608 21:7637636-7637658 ACCCAGAAGCTGCCAGAGGCTGG + Intergenic
1177175015 21:17693843-17693865 TCCCCAAAGCTGGCAGCTGCAGG - Intergenic
1179183176 21:39062275-39062297 TACCCACAGCTGCCCACGGCAGG + Intergenic
1179699311 21:43143850-43143872 GCACCACAGCTGCCAGAGGCAGG - Intergenic
1180032915 21:45224490-45224512 TCCCCACAGCTGCCCCACCCAGG - Exonic
1180783555 22:18534880-18534902 CCCACGAAGCAGCCCGAGGCAGG + Intergenic
1181127122 22:20708931-20708953 CCCACGAAGCAGCCCGAGGCAGG + Intronic
1181240457 22:21474232-21474254 CCCACGAAGCAGCCCGAGGCAGG + Intergenic
1181500606 22:23313641-23313663 TCCCCAGAGGAGCCCAAGGCAGG - Intronic
1182447507 22:30398094-30398116 TCCCCACTGCTGCCAGTGGCAGG - Intronic
1182547598 22:31084994-31085016 TCCCCAAATCGGCCAGACGCTGG - Intronic
1183672216 22:39279774-39279796 TTCCCAGAGATGCCCTAGGCGGG - Intergenic
1183957195 22:41387824-41387846 TCCACACAGTTCCCCGAGGCTGG + Intronic
1185235500 22:49710467-49710489 TCCCAAATGCTTCCCGAGCCAGG + Intergenic
1203239484 22_KI270733v1_random:1278-1300 ACCCAGAAGCTGCCAGAGGCTGG - Intergenic
952793356 3:37217724-37217746 TCCCCAAGTCTGCCTGAGTCTGG - Intergenic
953266326 3:41392602-41392624 TGCCCAAAGCTGAGCGAGCCTGG - Intronic
954953279 3:54493645-54493667 TCAGCAAAGATGCACGAGGCTGG - Intronic
957939885 3:86991104-86991126 TCCCCACGGCTGCCCGACCCGGG - Exonic
960950057 3:122993383-122993405 TCCTCAAAGCTGCCTGAGGATGG + Intronic
966780433 3:183579729-183579751 TCCCCAAATTTGCCCAAGGGTGG - Intergenic
966885169 3:184373463-184373485 TCCAGAAAGCTGCCCCAGGAGGG + Exonic
967721343 3:192819633-192819655 TTCCCAATTCTGCCTGAGGCTGG + Intronic
969447205 4:7252198-7252220 TCGCCAAGGAGGCCCGAGGCAGG + Intronic
969674534 4:8607628-8607650 TCCCCTGATCTCCCCGAGGCTGG + Intronic
969869417 4:10095448-10095470 TCCTCAAAGCTGACTGTGGCTGG + Intronic
972872792 4:43320993-43321015 TCCCCAGAGAGGCCCGAAGCTGG + Intergenic
976217808 4:82731307-82731329 TCCCCAAGGCTGTCCTAGCCAGG - Intronic
976600557 4:86934748-86934770 CCCCCACAGCAGCCCGGGGCAGG + Intronic
981936220 4:150242686-150242708 TCCCCAAAGCAGCCAGAGACAGG + Intronic
982287043 4:153746578-153746600 TGCCCATAGCTCTCCGAGGCTGG + Intronic
988483317 5:31647501-31647523 TCCCAGAAGCTGCAAGAGGCAGG - Intronic
997602456 5:135149907-135149929 TCCCCAGAGCTGCCTCAGGCAGG - Intronic
998040797 5:138950009-138950031 ACCCCAAAGCTTCCAGAGGCAGG + Intronic
1003053592 6:2800693-2800715 TCAGGAAAGCTGCCCGGGGCGGG + Intergenic
1004355032 6:14923336-14923358 TCCCCAGACCTGCTCGAGGGGGG + Intergenic
1006515558 6:34543892-34543914 TCCCCAAAGCTGCCCGAGGCTGG + Intronic
1012554184 6:100491594-100491616 TCCCCAAAGCTGTCCTTGGCAGG + Intergenic
1012945946 6:105465793-105465815 TTCCCAAAGCTGAATGAGGCTGG - Intergenic
1013823036 6:114178514-114178536 TTCCCAGAGCTGCCCTAGACAGG + Intronic
1019847679 7:3522657-3522679 TCTTCAAAACTGCCAGAGGCTGG + Intronic
1020461548 7:8434317-8434339 TTCCCACAGCTGCCTGAGGATGG - Exonic
1021849938 7:24797519-24797541 GCCCCAAAGCACCCCAAGGCTGG - Exonic
1022539559 7:31123364-31123386 TCCCCAAAGCTGCTAGTGCCAGG + Intergenic
1024197575 7:47074024-47074046 TCCCCAAAGCTGCCCAGGTCAGG - Intergenic
1029891399 7:103933752-103933774 GCCCCAAAGTTTCCAGAGGCTGG + Intronic
1033214467 7:139483492-139483514 TCCCGAAAGCAGCCCAAGTCCGG - Exonic
1034217426 7:149419255-149419277 TCCTCATAGCTGTCTGAGGCAGG + Intergenic
1034256811 7:149729215-149729237 TCCCCTACCCTGCCCGAGACGGG - Exonic
1034618120 7:152436148-152436170 TCCCCCGAGCCGCCCGCGGCAGG + Intergenic
1037880857 8:22572757-22572779 CCCCCAGGGCTGCTCGAGGCAGG - Intronic
1037884370 8:22588697-22588719 TCCCCAAAGCTCCACGGGGCAGG + Intronic
1040289654 8:46117786-46117808 TCCCCAAGGCTGTCCCAGGCAGG - Intergenic
1040298233 8:46174347-46174369 CCCCCACAGCTGTCCCAGGCAGG + Intergenic
1040302219 8:46194021-46194043 CCCCCAGTGCTGCCCCAGGCCGG + Intergenic
1040307210 8:46218299-46218321 CCCCCAAGGCTGTCCCAGGCCGG - Intergenic
1040310171 8:46232771-46232793 GCCCCAGAGCTGTCCCAGGCAGG + Intergenic
1040330906 8:46385322-46385344 CCCCCAAGGCTGCCCCGGGCTGG + Intergenic
1040334461 8:46409007-46409029 GCCCCAGAGCTGTCCCAGGCGGG + Intergenic
1044676393 8:94733058-94733080 ACCCCAAAACTTCCAGAGGCAGG - Intronic
1047447192 8:124930058-124930080 ACACCAAAGCTGCCTTAGGCAGG - Intergenic
1048197406 8:132343489-132343511 TACCCAAAGCTGGCAGAGGCTGG + Intronic
1049004708 8:139847480-139847502 TCCCCAGACCCGGCCGAGGCGGG - Intronic
1050151608 9:2622956-2622978 TTCCAAACGCCGCCCGAGGCGGG - Intronic
1052257547 9:26476100-26476122 TCCCCAAAGATGCCACATGCAGG - Intergenic
1059055064 9:110970837-110970859 TCTTCAAAGTTGCCCGAGGCCGG + Intronic
1060476115 9:123988073-123988095 ACACCACAGCTGCCCGGGGCTGG - Intergenic
1060794004 9:126502754-126502776 ACCCCAAACCTGGCTGAGGCTGG - Intronic
1061147718 9:128809409-128809431 CCCCCAAAGCTTTCCGAGTCTGG + Exonic
1061306860 9:129737316-129737338 TCCCCAAAACAATCCGAGGCAGG - Intergenic
1061478955 9:130887012-130887034 TCCCCGAGGCTGCCCCAGGCCGG + Intronic
1061489553 9:130937719-130937741 GCCCCAGGGCTGCCCCAGGCTGG - Intronic
1062022825 9:134327172-134327194 TCCCCAAAGCAGCCCACGCCCGG + Intronic
1062473761 9:136717843-136717865 TCTGCAAAGCTGCCTCAGGCTGG + Intronic
1062512447 9:136914233-136914255 TCCCCCAGGCTGCCCACGGCAGG - Intronic
1203422848 Un_GL000195v1:11173-11195 ACCCAGAAGCTGCCAGAGGCTGG + Intergenic
1185980733 X:4774955-4774977 ACCCAGAAGCTGCCAGAGGCCGG - Intergenic
1186230991 X:7453417-7453439 GCCTCAAAGCTTCCCAAGGCAGG - Intergenic
1189229162 X:39438653-39438675 TCCCCAAAACTCCCAGAGCCCGG - Intergenic
1189257741 X:39653484-39653506 GCCCCAAAGTTGCCCTAGACAGG - Intergenic
1189722061 X:43930258-43930280 TCCCCAATGCTGACCAGGGCTGG + Intergenic
1192044085 X:67653679-67653701 TGTCCATAGCTGCCCTAGGCTGG + Intronic
1192223145 X:69211027-69211049 TCCCCCCAGCTGCCACAGGCTGG + Intergenic
1197728547 X:129792351-129792373 TCCCCGAAGCTGCCAGAACCTGG - Exonic