ID: 1006519120

View in Genome Browser
Species Human (GRCh38)
Location 6:34561393-34561415
Sequence CAACATGGTGTCCTGGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006519120_1006519134 22 Left 1006519120 6:34561393-34561415 CCTCTCTCCAGGACACCATGTTG No data
Right 1006519134 6:34561438-34561460 CTGGGAAATAGCCCAGGGGGTGG No data
1006519120_1006519125 -3 Left 1006519120 6:34561393-34561415 CCTCTCTCCAGGACACCATGTTG No data
Right 1006519125 6:34561413-34561435 TTGCAGCTGGATGGTGAACAAGG No data
1006519120_1006519132 18 Left 1006519120 6:34561393-34561415 CCTCTCTCCAGGACACCATGTTG No data
Right 1006519132 6:34561434-34561456 GGGGCTGGGAAATAGCCCAGGGG No data
1006519120_1006519130 16 Left 1006519120 6:34561393-34561415 CCTCTCTCCAGGACACCATGTTG No data
Right 1006519130 6:34561432-34561454 AAGGGGCTGGGAAATAGCCCAGG No data
1006519120_1006519131 17 Left 1006519120 6:34561393-34561415 CCTCTCTCCAGGACACCATGTTG No data
Right 1006519131 6:34561433-34561455 AGGGGCTGGGAAATAGCCCAGGG No data
1006519120_1006519129 4 Left 1006519120 6:34561393-34561415 CCTCTCTCCAGGACACCATGTTG No data
Right 1006519129 6:34561420-34561442 TGGATGGTGAACAAGGGGCTGGG No data
1006519120_1006519126 -2 Left 1006519120 6:34561393-34561415 CCTCTCTCCAGGACACCATGTTG No data
Right 1006519126 6:34561414-34561436 TGCAGCTGGATGGTGAACAAGGG No data
1006519120_1006519128 3 Left 1006519120 6:34561393-34561415 CCTCTCTCCAGGACACCATGTTG No data
Right 1006519128 6:34561419-34561441 CTGGATGGTGAACAAGGGGCTGG No data
1006519120_1006519135 25 Left 1006519120 6:34561393-34561415 CCTCTCTCCAGGACACCATGTTG No data
Right 1006519135 6:34561441-34561463 GGAAATAGCCCAGGGGGTGGTGG No data
1006519120_1006519133 19 Left 1006519120 6:34561393-34561415 CCTCTCTCCAGGACACCATGTTG No data
Right 1006519133 6:34561435-34561457 GGGCTGGGAAATAGCCCAGGGGG No data
1006519120_1006519127 -1 Left 1006519120 6:34561393-34561415 CCTCTCTCCAGGACACCATGTTG No data
Right 1006519127 6:34561415-34561437 GCAGCTGGATGGTGAACAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006519120 Original CRISPR CAACATGGTGTCCTGGAGAG AGG (reversed) Intergenic