ID: 1006519127

View in Genome Browser
Species Human (GRCh38)
Location 6:34561415-34561437
Sequence GCAGCTGGATGGTGAACAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006519120_1006519127 -1 Left 1006519120 6:34561393-34561415 CCTCTCTCCAGGACACCATGTTG No data
Right 1006519127 6:34561415-34561437 GCAGCTGGATGGTGAACAAGGGG No data
1006519121_1006519127 -8 Left 1006519121 6:34561400-34561422 CCAGGACACCATGTTGCAGCTGG No data
Right 1006519127 6:34561415-34561437 GCAGCTGGATGGTGAACAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006519127 Original CRISPR GCAGCTGGATGGTGAACAAG GGG Intergenic