ID: 1006519128

View in Genome Browser
Species Human (GRCh38)
Location 6:34561419-34561441
Sequence CTGGATGGTGAACAAGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006519120_1006519128 3 Left 1006519120 6:34561393-34561415 CCTCTCTCCAGGACACCATGTTG No data
Right 1006519128 6:34561419-34561441 CTGGATGGTGAACAAGGGGCTGG No data
1006519121_1006519128 -4 Left 1006519121 6:34561400-34561422 CCAGGACACCATGTTGCAGCTGG No data
Right 1006519128 6:34561419-34561441 CTGGATGGTGAACAAGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006519128 Original CRISPR CTGGATGGTGAACAAGGGGC TGG Intergenic