ID: 1006519128 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:34561419-34561441 |
Sequence | CTGGATGGTGAACAAGGGGC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1006519120_1006519128 | 3 | Left | 1006519120 | 6:34561393-34561415 | CCTCTCTCCAGGACACCATGTTG | No data | ||
Right | 1006519128 | 6:34561419-34561441 | CTGGATGGTGAACAAGGGGCTGG | No data | ||||
1006519121_1006519128 | -4 | Left | 1006519121 | 6:34561400-34561422 | CCAGGACACCATGTTGCAGCTGG | No data | ||
Right | 1006519128 | 6:34561419-34561441 | CTGGATGGTGAACAAGGGGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1006519128 | Original CRISPR | CTGGATGGTGAACAAGGGGC TGG | Intergenic | ||