ID: 1006519133

View in Genome Browser
Species Human (GRCh38)
Location 6:34561435-34561457
Sequence GGGCTGGGAAATAGCCCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006519124_1006519133 4 Left 1006519124 6:34561408-34561430 CCATGTTGCAGCTGGATGGTGAA No data
Right 1006519133 6:34561435-34561457 GGGCTGGGAAATAGCCCAGGGGG No data
1006519120_1006519133 19 Left 1006519120 6:34561393-34561415 CCTCTCTCCAGGACACCATGTTG No data
Right 1006519133 6:34561435-34561457 GGGCTGGGAAATAGCCCAGGGGG No data
1006519121_1006519133 12 Left 1006519121 6:34561400-34561422 CCAGGACACCATGTTGCAGCTGG No data
Right 1006519133 6:34561435-34561457 GGGCTGGGAAATAGCCCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006519133 Original CRISPR GGGCTGGGAAATAGCCCAGG GGG Intergenic