ID: 1006519134

View in Genome Browser
Species Human (GRCh38)
Location 6:34561438-34561460
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006519121_1006519134 15 Left 1006519121 6:34561400-34561422 CCAGGACACCATGTTGCAGCTGG No data
Right 1006519134 6:34561438-34561460 CTGGGAAATAGCCCAGGGGGTGG No data
1006519120_1006519134 22 Left 1006519120 6:34561393-34561415 CCTCTCTCCAGGACACCATGTTG No data
Right 1006519134 6:34561438-34561460 CTGGGAAATAGCCCAGGGGGTGG No data
1006519124_1006519134 7 Left 1006519124 6:34561408-34561430 CCATGTTGCAGCTGGATGGTGAA No data
Right 1006519134 6:34561438-34561460 CTGGGAAATAGCCCAGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006519134 Original CRISPR CTGGGAAATAGCCCAGGGGG TGG Intergenic